EMAIL THIS PAGE TO A FRIEND

NAA15

N(alpha)-acetyltransferase 15, NatA auxiliary subunit

242 Gene Product Result for
Synonyms: Ga19 NARG1 NATH TBDN100
UniProtKB ID: Q9BXJ9, D3DNY6, Q52LG9, Q8IWH4, Q8NEV2, Q9H8P6
Gene ID:
Human(80155) Summary: This gene encodes a protein of unknown function. However, similarity to proteins in yeast and other species suggests that this protein may be an N-acetyltransferase. [provided by RefSeq, Jul 2008]
Mouse(74838) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Rat(310399) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
chicken(422440) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
dog(483817) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
cow(536676) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Horse(100063328) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
domestic cat(101091444) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
naked mole-rat(101713726) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Domestic Rabbit(100343409) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
domestic guinea pig(100730022) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
sheep(101105853) N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_057175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057175 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_053089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025085 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_057175 Rosetta Predictions human pricing
NM_001107674 Rosetta Predictions rat pricing
NM_053089 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362038 predicted 2377
2 SASI_Hs01_00214338 predicted 1847
3 SASI_Hs01_00214340 predicted 2663
4 SASI_Hs01_00214341 predicted 2773
5 SASI_Hs01_00214342 predicted 440
6 SASI_Hs01_00214343 predicted 1444
7 SASI_Hs02_00362039 predicted 1030
8 SASI_Hs01_00214344 predicted 2880
9 SASI_Hs02_00362040 predicted 1293
10 SASI_Hs01_00214345 predicted 1377
11 SASI_Hs01_00214339 predicted 496
12 SASI_Hs01_00214346 predicted 840
13 SASI_Hs01_00214347 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107674 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231155 predicted 328
2 SASI_Rn02_00231156 predicted 1005
3 SASI_Rn02_00231157 predicted 1442
4 SASI_Rn02_00231158 predicted 2751
5 SASI_Rn02_00231159 predicted 2504
6 SASI_Rn02_00231160 predicted 2758
7 SASI_Rn02_00231161 predicted 693
8 SASI_Rn02_00231162 predicted 874
9 SASI_Rn02_00231163 predicted 1102
10 SASI_Rn02_00231164 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198428 predicted 2532
2 SASI_Mm01_00198429 predicted 345
3 SASI_Mm01_00198430 predicted 970
4 SASI_Mm01_00198431 predicted 1408
5 SASI_Mm01_00198432 predicted 2466
6 SASI_Mm02_00337584 predicted 1407
7 SASI_Mm01_00198433 predicted 1073
8 SASI_Mm01_00198435 predicted 750
9 SASI_Mm01_00198436 predicted 915
10 SASI_Mm01_00198437 predicted 1321
11 SASI_Mm01_00198434 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057175
NAA15 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-1054s21c1
Sequence:CCGGAGCACTCAAGCCAGCTAATATCTCGAGATATTAGCTGGCTTGAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-1819s21c1
Sequence:CCGGCCAGTTTGACTTTCATACATACTCGAGTATGTATGAAAGTCAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-551s21c1
Sequence:CCGGGCCATTAAGTGTTACAGAAATCTCGAGATTTCTGTAACACTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-2029s21c1
Sequence:CCGGGCTAAAGAAGCTACGTAATAACTCGAGTTATTACGTAGCTTCTTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057175.3-2887s21c1
Sequence:CCGGTTGGACCATATCTAGTATATACTCGAGTATATACTAGATATGGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057175
NAA15 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-1054s21c1
Sequence:CCGGAGCACTCAAGCCAGCTAATATCTCGAGATATTAGCTGGCTTGAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-1819s21c1
Sequence:CCGGCCAGTTTGACTTTCATACATACTCGAGTATGTATGAAAGTCAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-551s21c1
Sequence:CCGGGCCATTAAGTGTTACAGAAATCTCGAGATTTCTGTAACACTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-2029s21c1
Sequence:CCGGGCTAAAGAAGCTACGTAATAACTCGAGTTATTACGTAGCTTCTTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057175.3-2887s21c1
Sequence:CCGGTTGGACCATATCTAGTATATACTCGAGTATATACTAGATATGGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057175
NAA15 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-1054s21c1
Sequence:CCGGAGCACTCAAGCCAGCTAATATCTCGAGATATTAGCTGGCTTGAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-1819s21c1
Sequence:CCGGCCAGTTTGACTTTCATACATACTCGAGTATGTATGAAAGTCAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-551s21c1
Sequence:CCGGGCCATTAAGTGTTACAGAAATCTCGAGATTTCTGTAACACTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057175.3-2029s21c1
Sequence:CCGGGCTAAAGAAGCTACGTAATAACTCGAGTTATTACGTAGCTTCTTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304136    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057175.3-2887s21c1
Sequence:CCGGTTGGACCATATCTAGTATATACTCGAGTATATACTAGATATGGTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053089
VALIDATED
NAA15 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053089.2-3831s1c1
Sequence:CCGGGCCCTTCATTTCTAAGAATATCTCGAGATATTCTTAGAAATGAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053089.2-2374s1c1
Sequence:CCGGCCGAAACAGTTAGAACAGTATCTCGAGATACTGTTCTAACTGTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053089.2-972s1c1
Sequence:CCGGGCCTATTACAAAGGCTTAGAACTCGAGTTCTAAGCCTTTGTAATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053089.2-2373s1c1
Sequence:CCGGCCCGAAACAGTTAGAACAGTACTCGAGTACTGTTCTAACTGTTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053089.2-1410s1c1
Sequence:CCGGCCAACATTGATAGAACTCTTTCTCGAGAAAGAGTTCTATCAATGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053089
VALIDATED
NAA15 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053089.2-3831s1c1
Sequence:CCGGGCCCTTCATTTCTAAGAATATCTCGAGATATTCTTAGAAATGAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053089.2-2374s1c1
Sequence:CCGGCCGAAACAGTTAGAACAGTATCTCGAGATACTGTTCTAACTGTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053089.2-972s1c1
Sequence:CCGGGCCTATTACAAAGGCTTAGAACTCGAGTTCTAAGCCTTTGTAATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053089.2-2373s1c1
Sequence:CCGGCCCGAAACAGTTAGAACAGTACTCGAGTACTGTTCTAACTGTTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053089.2-1410s1c1
Sequence:CCGGCCAACATTGATAGAACTCTTTCTCGAGAAAGAGTTCTATCAATGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053089
VALIDATED
NAA15 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053089.2-3831s1c1
Sequence:CCGGGCCCTTCATTTCTAAGAATATCTCGAGATATTCTTAGAAATGAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053089.2-2374s1c1
Sequence:CCGGCCGAAACAGTTAGAACAGTATCTCGAGATACTGTTCTAACTGTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053089.2-972s1c1
Sequence:CCGGGCCTATTACAAAGGCTTAGAACTCGAGTTCTAAGCCTTTGTAATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053089.2-2373s1c1
Sequence:CCGGCCCGAAACAGTTAGAACAGTACTCGAGTACTGTTCTAACTGTTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053089.2-1410s1c1
Sequence:CCGGCCAACATTGATAGAACTCTTTCTCGAGAAAGAGTTCTATCAATGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025085
VALIDATED
NAA15 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025085.2-1055s1c1
Sequence:CCGGCCTATTACAAAGGCTTGGAAACTCGAGTTTCCAAGCCTTTGTAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-574s1c1
Sequence:CCGGGCCATTAAGTGTTACAGAAATCTCGAGATTTCTGTAACACTTAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-1297s1c1
Sequence:CCGGGCAATCATAGAAGAGTTAGTACTCGAGTACTAACTCTTCTATGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-1703s1c1
Sequence:CCGGCGGTAGAGAATTTGAATGAAACTCGAGTTTCATTCAAATTCTCTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-1832s1c1
Sequence:CCGGCCAGTTTGACTTTCATACATACTCGAGTATGTATGAAAGTCAAACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025085
VALIDATED
NAA15 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025085.2-1055s1c1
Sequence:CCGGCCTATTACAAAGGCTTGGAAACTCGAGTTTCCAAGCCTTTGTAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-574s1c1
Sequence:CCGGGCCATTAAGTGTTACAGAAATCTCGAGATTTCTGTAACACTTAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-1297s1c1
Sequence:CCGGGCAATCATAGAAGAGTTAGTACTCGAGTACTAACTCTTCTATGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-1703s1c1
Sequence:CCGGCGGTAGAGAATTTGAATGAAACTCGAGTTTCATTCAAATTCTCTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-1832s1c1
Sequence:CCGGCCAGTTTGACTTTCATACATACTCGAGTATGTATGAAAGTCAAACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025085
VALIDATED
NAA15 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 15, NatA auxiliary subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025085.2-1055s1c1
Sequence:CCGGCCTATTACAAAGGCTTGGAAACTCGAGTTTCCAAGCCTTTGTAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-574s1c1
Sequence:CCGGGCCATTAAGTGTTACAGAAATCTCGAGATTTCTGTAACACTTAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-1297s1c1
Sequence:CCGGGCAATCATAGAAGAGTTAGTACTCGAGTACTAACTCTTCTATGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061328    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-1703s1c1
Sequence:CCGGCGGTAGAGAATTTGAATGAAACTCGAGTTTCATTCAAATTCTCTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_025085.2-1832s1c1
Sequence:CCGGCCAGTTTGACTTTCATACATACTCGAGTATGTATGAAAGTCAAACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)