EMAIL THIS PAGE TO A FRIEND

NAA16

N(alpha)-acetyltransferase 16, NatA auxiliary subunit

101 Gene Product Result for
Synonyms: NARG1L
UniProtKB ID: Q6N069, B0QZ59, Q5VSP9, Q6P2D5, Q8N5J3, Q8N870
Gene ID:
Mouse(66897) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Rat(686240) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
chicken(418832) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
dog(485464) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Horse(100061122) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
cow(538989) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
domestic cat(101090579) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
sheep(101123132) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
domestic guinea pig(100730500) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Domestic Rabbit(100342198) N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
A3903 1-Aminocyclopropanecarboxylic acid ≥98% (TLC) human, mouse, rat pricing
C8005 D-Cysteine hydrochloride monohydrate ≥98% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018527 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018527 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018527 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110798 Rosetta Predictions human pricing
NM_018527 Rosetta Predictions human pricing
NM_024561 Rosetta Predictions human pricing
XM_001073036 Rosetta Predictions rat pricing
XM_001073064 Rosetta Predictions rat pricing
NM_025832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325045 predicted 965
2 SASI_Hs02_00325046 predicted 629
3 SASI_Hs02_00325047 predicted 559
4 SASI_Hs02_00325048 predicted 707
5 SASI_Hs02_00325049 predicted 581
6 SASI_Hs02_00325050 predicted 461
7 SASI_Hs02_00325051 predicted 378
8 SASI_Hs02_00325052 predicted 725
9 SASI_Hs02_00325053 predicted 885
10 SASI_Hs02_00325054 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064370 predicted 893
2 SASI_Hs01_00064371 predicted 551
3 SASI_Hs01_00064372 predicted 484
4 SASI_Hs01_00064373 predicted 631
5 SASI_Hs01_00064374 predicted 501
6 SASI_Hs01_00064375 predicted 387
7 SASI_Hs01_00064376 predicted 304
8 SASI_Hs01_00064377 predicted 647
9 SASI_Hs01_00064378 predicted 812
10 SASI_Hs01_00064379 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024561 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034955 predicted 970
2 SASI_Hs01_00034956 predicted 631
3 SASI_Hs01_00034957 predicted 560
4 SASI_Hs01_00034958 predicted 708
5 SASI_Hs01_00034959 predicted 577
6 SASI_Hs01_00034960 predicted 460
7 SASI_Hs01_00034961 predicted 381
8 SASI_Hs01_00034962 predicted 728
9 SASI_Hs01_00034963 predicted 892
10 SASI_Hs01_00034964 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073036 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341337 predicted 286
2 SASI_Rn02_00341338 predicted 443
3 SASI_Rn02_00341339 predicted 1344
4 SASI_Rn02_00341340 predicted 549
5 SASI_Rn02_00341341 predicted 194
6 SASI_Rn02_00341342 predicted 1462
7 SASI_Rn02_00341343 predicted 1264
8 SASI_Rn02_00341344 predicted 1597
9 SASI_Rn02_00341345 predicted 768
10 SASI_Rn02_00341346 predicted 524
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073064 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341404 predicted 290
2 SASI_Rn02_00341405 predicted 451
3 SASI_Rn02_00341406 predicted 1342
4 SASI_Rn02_00341407 predicted 545
5 SASI_Rn02_00341408 predicted 201
6 SASI_Rn02_00341409 predicted 1457
7 SASI_Rn02_00341410 predicted 1254
8 SASI_Rn02_00341411 predicted 1294
9 SASI_Rn02_00341412 predicted 1591
10 SASI_Rn02_00341413 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120410 predicted 2280
2 SASI_Mm01_00120411 predicted 2338
3 SASI_Mm01_00120412 predicted 1659
4 SASI_Mm01_00120413 predicted 1197
5 SASI_Mm01_00120414 predicted 1167
6 SASI_Mm01_00120415 predicted 459
7 SASI_Mm01_00120416 predicted 1254
8 SASI_Mm01_00120417 predicted 954
9 SASI_Mm01_00120418 predicted 851
10 SASI_Mm01_00120419 predicted 1498
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025832
VALIDATED
NAA16 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025832.2-957s1c1
Sequence:CCGGCCAGGTAAGAAGTTTCGAGAACTCGAGTTCTCGAAACTTCTTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025832.2-1628s1c1
Sequence:CCGGCCATACATACTGCATGAGAAACTCGAGTTTCTCATGCAGTATGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025832.2-2991s1c1
Sequence:CCGGGCCTTCAATTTACATGGACATCTCGAGATGTCCATGTAAATTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025832.2-2146s1c1
Sequence:CCGGCCTTTGCCATTGAAAGTAATACTCGAGTATTACTTTCAATGGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025832.2-2503s1c1
Sequence:CCGGGCTCCCAATATGAAGAGTATACTCGAGTATACTCTTCATATTGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025832
VALIDATED
NAA16 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025832.2-957s1c1
Sequence:CCGGCCAGGTAAGAAGTTTCGAGAACTCGAGTTCTCGAAACTTCTTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025832.2-1628s1c1
Sequence:CCGGCCATACATACTGCATGAGAAACTCGAGTTTCTCATGCAGTATGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025832.2-2991s1c1
Sequence:CCGGGCCTTCAATTTACATGGACATCTCGAGATGTCCATGTAAATTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025832.2-2146s1c1
Sequence:CCGGCCTTTGCCATTGAAAGTAATACTCGAGTATTACTTTCAATGGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025832.2-2503s1c1
Sequence:CCGGGCTCCCAATATGAAGAGTATACTCGAGTATACTCTTCATATTGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025832
VALIDATED
NAA16 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025832.2-957s1c1
Sequence:CCGGCCAGGTAAGAAGTTTCGAGAACTCGAGTTCTCGAAACTTCTTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025832.2-1628s1c1
Sequence:CCGGCCATACATACTGCATGAGAAACTCGAGTTTCTCATGCAGTATGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114631    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025832.2-2991s1c1
Sequence:CCGGGCCTTCAATTTACATGGACATCTCGAGATGTCCATGTAAATTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025832.2-2146s1c1
Sequence:CCGGCCTTTGCCATTGAAAGTAATACTCGAGTATTACTTTCAATGGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025832.2-2503s1c1
Sequence:CCGGGCTCCCAATATGAAGAGTATACTCGAGTATACTCTTCATATTGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018527
NAA16 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-563s1c1
Sequence:CCGGGCCCTCAAATTAGATAAAGATCTCGAGATCTTTATCTAATTTGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-716s1c1
Sequence:CCGGGCATACCATTTGCTGAAAGATCTCGAGATCTTTCAGCAAATGGTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-1110s1c1
Sequence:CCGGCCAAAGCAATTACACCCAGAACTCGAGTTCTGGGTGTAATTGCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-293s1c1
Sequence:CCGGCGCATCTTGAAATGTTATGAACTCGAGTTCATAACATTTCAAGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-1046s1c1
Sequence:CCGGGCTCTACAAATTAGCACTTTACTCGAGTAAAGTGCTAATTTGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018527
NAA16 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-563s1c1
Sequence:CCGGGCCCTCAAATTAGATAAAGATCTCGAGATCTTTATCTAATTTGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-716s1c1
Sequence:CCGGGCATACCATTTGCTGAAAGATCTCGAGATCTTTCAGCAAATGGTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-1110s1c1
Sequence:CCGGCCAAAGCAATTACACCCAGAACTCGAGTTCTGGGTGTAATTGCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-293s1c1
Sequence:CCGGCGCATCTTGAAATGTTATGAACTCGAGTTCATAACATTTCAAGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-1046s1c1
Sequence:CCGGGCTCTACAAATTAGCACTTTACTCGAGTAAAGTGCTAATTTGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018527
NAA16 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-563s1c1
Sequence:CCGGGCCCTCAAATTAGATAAAGATCTCGAGATCTTTATCTAATTTGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-716s1c1
Sequence:CCGGGCATACCATTTGCTGAAAGATCTCGAGATCTTTCAGCAAATGGTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-1110s1c1
Sequence:CCGGCCAAAGCAATTACACCCAGAACTCGAGTTCTGGGTGTAATTGCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-293s1c1
Sequence:CCGGCGCATCTTGAAATGTTATGAACTCGAGTTCATAACATTTCAAGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018527.2-1046s1c1
Sequence:CCGGGCTCTACAAATTAGCACTTTACTCGAGTAAAGTGCTAATTTGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)