EMAIL THIS PAGE TO A FRIEND

NAA25

N(alpha)-acetyltransferase 25, NatB auxiliary subunit

155 Gene Product Result for
Synonyms: C12orf30 MDM20 NAP1
UniProtKB ID: Q14CX7, A0JLU7, Q6MZH1, Q7Z4N6, Q9H911
Gene ID:
Human(80018) Summary: This gene encodes the auxiliary subunit of the heteromeric N-terminal acetyltransferase B complex. This complex acetylates methionine residues that are followed by acidic or asparagine residues.[provided by RefSeq, Mar 2010]
Mouse(231713) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Rat(360811) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Zebrafish(568789) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
cow(613372) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Horse(100057219) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
dog(486274) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
chicken(416883) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
sheep(101115483) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
domestic guinea pig(100731976) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
naked mole-rat(101724988) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Domestic Rabbit(100354816) N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024953 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024953 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024953 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024953 Rosetta Predictions human pricing
NM_001047900 Rosetta Predictions rat pricing
NM_172722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084359 predicted 940
2 SASI_Hs01_00084360 predicted 2854
3 SASI_Hs01_00084361 predicted 1921
4 SASI_Hs01_00084362 predicted 1560
5 SASI_Hs01_00084363 predicted 2071
6 SASI_Hs01_00084364 predicted 2401
7 SASI_Hs01_00084365 predicted 1000
8 SASI_Hs01_00084366 predicted 694
9 SASI_Hs01_00084367 predicted 930
10 SASI_Hs01_00084368 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206617 predicted 922
2 SASI_Rn02_00206618 predicted 2376
3 SASI_Rn02_00206619 predicted 457
4 SASI_Rn02_00206620 predicted 2055
5 SASI_Rn02_00206621 predicted 1802
6 SASI_Rn02_00206622 predicted 787
7 SASI_Rn02_00206623 predicted 908
8 SASI_Rn02_00206624 predicted 1724
9 SASI_Rn02_00206625 predicted 771
10 SASI_Rn02_00206626 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146554 predicted 2400
2 SASI_Mm01_00146556 predicted 1643
3 SASI_Mm01_00146558 predicted 2861
4 SASI_Mm01_00146559 predicted 1371
5 SASI_Mm01_00146560 predicted 944
6 SASI_Mm01_00146561 predicted 1740
7 SASI_Mm02_00344523 predicted 2046
8 SASI_Mm01_00146562 predicted 1879
9 SASI_Mm01_00146563 predicted 796
10 SASI_Mm02_00344524 predicted 2072
11 SASI_Mm01_00146555 predicted 1922
12 SASI_Mm01_00146557 predicted 938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024953
VALIDATED
NAA25 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024953.2-1020s21c1
Sequence:CCGGTTACGAAGTCAAGGTTGTAACCTCGAGGTTACAACCTTGACTTCGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024953.2-3305s21c1
Sequence:CCGGGAATAGCCCTTCCATTATAAACTCGAGTTTATAATGGAAGGGCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024953.2-982s21c1
Sequence:CCGGGAGGACCACATCTAGCTAAATCTCGAGATTTAGCTAGATGTGGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024953.2-3187s21c1
Sequence:CCGGGCAACAAGAGAACCCTACTTTCTCGAGAAAGTAGGGTTCTCTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024953.2-2670s21c1
Sequence:CCGGCCACCTGTCTTTACCAGTTTCCTCGAGGAAACTGGTAAAGACAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024953.2-4671s1c1
Sequence:CCGGGCCTGTTTAAGATGGAACTTTCTCGAGAAAGTTCCATCTTAAACAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024953.2-120s1c1
Sequence:CCGGGCAGATAAACTGTTGAAGAAACTCGAGTTTCTTCAACAGTTTATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024953.2-2186s1c1
Sequence:CCGGCCGGATTGATATTCTTCGTTTCTCGAGAAACGAAGAATATCAATCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024953.2-924s1c1
Sequence:CCGGGCTGTGAAGTTTATAGAAGATCTCGAGATCTTCTATAAACTTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024953.2-1631s1c1
Sequence:CCGGCCAGCATGATACCATTGGTTACTCGAGTAACCAATGGTATCATGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024953
VALIDATED
NAA25 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024953.2-1020s21c1
Sequence:CCGGTTACGAAGTCAAGGTTGTAACCTCGAGGTTACAACCTTGACTTCGTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024953.2-3305s21c1
Sequence:CCGGGAATAGCCCTTCCATTATAAACTCGAGTTTATAATGGAAGGGCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024953.2-982s21c1
Sequence:CCGGGAGGACCACATCTAGCTAAATCTCGAGATTTAGCTAGATGTGGTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024953.2-3187s21c1
Sequence:CCGGGCAACAAGAGAACCCTACTTTCTCGAGAAAGTAGGGTTCTCTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024953.2-2670s21c1
Sequence:CCGGCCACCTGTCTTTACCAGTTTCCTCGAGGAAACTGGTAAAGACAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024953.2-4671s1c1
Sequence:CCGGGCCTGTTTAAGATGGAACTTTCTCGAGAAAGTTCCATCTTAAACAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024953.2-120s1c1
Sequence:CCGGGCAGATAAACTGTTGAAGAAACTCGAGTTTCTTCAACAGTTTATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024953.2-2186s1c1
Sequence:CCGGCCGGATTGATATTCTTCGTTTCTCGAGAAACGAAGAATATCAATCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024953.2-924s1c1
Sequence:CCGGGCTGTGAAGTTTATAGAAGATCTCGAGATCTTCTATAAACTTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024953.2-1631s1c1
Sequence:CCGGCCAGCATGATACCATTGGTTACTCGAGTAACCAATGGTATCATGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024953
VALIDATED
NAA25 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024953.2-1020s21c1
Sequence:CCGGTTACGAAGTCAAGGTTGTAACCTCGAGGTTACAACCTTGACTTCGTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024953.2-3305s21c1
Sequence:CCGGGAATAGCCCTTCCATTATAAACTCGAGTTTATAATGGAAGGGCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024953.2-982s21c1
Sequence:CCGGGAGGACCACATCTAGCTAAATCTCGAGATTTAGCTAGATGTGGTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024953.2-3187s21c1
Sequence:CCGGGCAACAAGAGAACCCTACTTTCTCGAGAAAGTAGGGTTCTCTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024953.2-2670s21c1
Sequence:CCGGCCACCTGTCTTTACCAGTTTCCTCGAGGAAACTGGTAAAGACAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024953.2-4671s1c1
Sequence:CCGGGCCTGTTTAAGATGGAACTTTCTCGAGAAAGTTCCATCTTAAACAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024953.2-120s1c1
Sequence:CCGGGCAGATAAACTGTTGAAGAAACTCGAGTTTCTTCAACAGTTTATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024953.2-2186s1c1
Sequence:CCGGCCGGATTGATATTCTTCGTTTCTCGAGAAACGAAGAATATCAATCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_024953.2-924s1c1
Sequence:CCGGGCTGTGAAGTTTATAGAAGATCTCGAGATCTTCTATAAACTTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_024953.2-1631s1c1
Sequence:CCGGCCAGCATGATACCATTGGTTACTCGAGTAACCAATGGTATCATGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172722
VALIDATED
NAA25 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-2606s1c1
Sequence:CCGGCTTGCGACCATACAAATTAAACTCGAGTTTAATTTGTATGGTCGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-2549s1c1
Sequence:CCGGCTTCTTCGTTGAGACTATTTCCTCGAGGAAATAGTCTCAACGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-1531s1c1
Sequence:CCGGCATCCAATGCTCAGTTCAAATCTCGAGATTTGAACTGAGCATTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-1403s1c1
Sequence:CCGGGTTGCAGTTCTCAGACTATTACTCGAGTAATAGTCTGAGAACTGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-2728s1c1
Sequence:CCGGCCAATGCTGTGGATCATATTACTCGAGTAATATGATCCACAGCATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-110s1c1
Sequence:CCGGGGCAATTCAGCAAGCTGATAACTCGAGTTATCAGCTTGCTGAATTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172722.1-948s1c1
Sequence:CCGGGCATCACAAAGCTCTCGACATCTCGAGATGTCGAGAGCTTTGTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172722.1-1056s1c1
Sequence:CCGGGAAGAGTTAATGTTCCAGTATCTCGAGATACTGGAACATTAACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172722.1-1295s1c1
Sequence:CCGGCAGCATGGATAAGAGTCAGAACTCGAGTTCTGACTCTTATCCATGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172722.1-57s1c1
Sequence:CCGGCGGCCCATTTACGATTATCTTCTCGAGAAGATAATCGTAAATGGGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.1-475s1c1
Sequence:CCGGGCTTGATCATGCAATCTATATCTCGAGATATAGATTGCATGATCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172722
VALIDATED
NAA25 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-2606s1c1
Sequence:CCGGCTTGCGACCATACAAATTAAACTCGAGTTTAATTTGTATGGTCGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-2549s1c1
Sequence:CCGGCTTCTTCGTTGAGACTATTTCCTCGAGGAAATAGTCTCAACGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-1531s1c1
Sequence:CCGGCATCCAATGCTCAGTTCAAATCTCGAGATTTGAACTGAGCATTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-1403s1c1
Sequence:CCGGGTTGCAGTTCTCAGACTATTACTCGAGTAATAGTCTGAGAACTGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-2728s1c1
Sequence:CCGGCCAATGCTGTGGATCATATTACTCGAGTAATATGATCCACAGCATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-110s1c1
Sequence:CCGGGGCAATTCAGCAAGCTGATAACTCGAGTTATCAGCTTGCTGAATTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172722.1-948s1c1
Sequence:CCGGGCATCACAAAGCTCTCGACATCTCGAGATGTCGAGAGCTTTGTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172722.1-1056s1c1
Sequence:CCGGGAAGAGTTAATGTTCCAGTATCTCGAGATACTGGAACATTAACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172722.1-1295s1c1
Sequence:CCGGCAGCATGGATAAGAGTCAGAACTCGAGTTCTGACTCTTATCCATGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172722.1-57s1c1
Sequence:CCGGCGGCCCATTTACGATTATCTTCTCGAGAAGATAATCGTAAATGGGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.1-475s1c1
Sequence:CCGGGCTTGATCATGCAATCTATATCTCGAGATATAGATTGCATGATCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172722
VALIDATED
NAA25 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 25, NatB auxiliary subunit
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215792    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-2606s1c1
Sequence:CCGGCTTGCGACCATACAAATTAAACTCGAGTTTAATTTGTATGGTCGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-2549s1c1
Sequence:CCGGCTTCTTCGTTGAGACTATTTCCTCGAGGAAATAGTCTCAACGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216126    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-1531s1c1
Sequence:CCGGCATCCAATGCTCAGTTCAAATCTCGAGATTTGAACTGAGCATTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-1403s1c1
Sequence:CCGGGTTGCAGTTCTCAGACTATTACTCGAGTAATAGTCTGAGAACTGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217225    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-2728s1c1
Sequence:CCGGCCAATGCTGTGGATCATATTACTCGAGTAATATGATCCACAGCATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217493    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.3-110s1c1
Sequence:CCGGGGCAATTCAGCAAGCTGATAACTCGAGTTATCAGCTTGCTGAATTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181777    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172722.1-948s1c1
Sequence:CCGGGCATCACAAAGCTCTCGACATCTCGAGATGTCGAGAGCTTTGTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172722.1-1056s1c1
Sequence:CCGGGAAGAGTTAATGTTCCAGTATCTCGAGATACTGGAACATTAACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172722.1-1295s1c1
Sequence:CCGGCAGCATGGATAAGAGTCAGAACTCGAGTTCTGACTCTTATCCATGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172722.1-57s1c1
Sequence:CCGGCGGCCCATTTACGATTATCTTCTCGAGAAGATAATCGTAAATGGGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197966    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172722.1-475s1c1
Sequence:CCGGGCTTGATCATGCAATCTATATCTCGAGATATAGATTGCATGATCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)