EMAIL THIS PAGE TO A FRIEND

NAA30

N(alpha)-acetyltransferase 30, NatC catalytic subunit

218 Gene Product Result for
Synonyms: C14orf35 MAK3 Mak3p NAT12
UniProtKB ID: Q147X3, Q0IIN2
Gene ID:
Mouse(70646) N(alpha)-acetyltransferase 30, NatC catalytic subunit
Rat(498489) N(alpha)-acetyltransferase 30, NatC catalytic subunit
naked mole-rat(101698630) N(alpha)-acetyltransferase 30, NatC catalytic subunit
domestic guinea pig(100731754) N(alpha)-acetyltransferase 30, NatC catalytic subunit
Zebrafish(100192212) N(alpha)-acetyltransferase 30, NatC catalytic subunit
dog(612880) N(alpha)-acetyltransferase 30, NatC catalytic subunit
cow(533922) N(alpha)-acetyltransferase 30, NatC catalytic subunit
domestic cat(101097155) N(alpha)-acetyltransferase 30, NatC catalytic subunit
chicken(423547) N(alpha)-acetyltransferase 30, NatC catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001011713 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001011713 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001011713 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081430 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081430 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081430 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011713 Rosetta Predictions human pricing
NM_001109099 Rosetta Predictions rat pricing
NM_001081430 Rosetta Predictions mouse pricing
XM_283206 Rosetta Predictions mouse pricing
XM_900214 Rosetta Predictions mouse pricing
XM_991662 Rosetta Predictions mouse pricing
XM_991692 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078242 predicted 827
2 SASI_Hs01_00078244 predicted 1046
3 SASI_Hs01_00078245 predicted 1278
4 SASI_Hs02_00306032 predicted 954
5 SASI_Hs01_00078246 predicted 1048
6 SASI_Hs01_00078247 predicted 1207
7 SASI_Hs01_00078248 predicted 815
8 SASI_Hs01_00078249 predicted 937
9 SASI_Hs01_00078251 predicted 1259
10 SASI_Hs02_00306033 predicted 834
11 SASI_Hs01_00078243 predicted 990
12 SASI_Hs01_00078250 predicted 1055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245120 predicted 915
2 SASI_Rn02_00245121 predicted 825
3 SASI_Rn02_00245122 predicted 713
4 SASI_Rn02_00245123 predicted 899
5 SASI_Rn02_00245124 predicted 706
6 SASI_Rn02_00245125 predicted 804
7 SASI_Rn02_00245126 predicted 632
8 SASI_Rn02_00245127 predicted 670
9 SASI_Rn02_00245128 predicted 651
10 SASI_Rn02_00245129 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298301 predicted 1055
2 SASI_Mm02_00298302 predicted 924
3 SASI_Mm02_00298303 predicted 990
4 SASI_Mm02_00298304 predicted 1064
5 SASI_Mm02_00298305 predicted 1051
6 SASI_Mm02_00298306 predicted 860
7 SASI_Mm02_00298307 predicted 972
8 SASI_Mm02_00298308 predicted 830
9 SASI_Mm02_00298309 predicted 1314
10 SASI_Mm02_00298310 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226680 predicted 1522
2 SASI_Mm01_00226681 predicted 1554
3 SASI_Mm01_00226682 predicted 1386
4 SASI_Mm01_00226683 predicted 1518
5 SASI_Mm01_00226684 predicted 1311
6 SASI_Mm01_00226685 predicted 1478
7 SASI_Mm01_00226686 predicted 1368
8 SASI_Mm01_00226687 predicted 1619
9 SASI_Mm01_00226688 predicted 1196
10 SASI_Mm01_00226689 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259880 predicted 276
2 SASI_Mm01_00259881 predicted 745
3 SASI_Mm01_00259882 predicted 209
4 SASI_Mm01_00259883 predicted 289
5 SASI_Mm01_00259884 predicted 302
6 SASI_Mm01_00259885 predicted 264
7 SASI_Mm01_00259886 predicted 611
8 SASI_Mm01_00259887 predicted 544
9 SASI_Mm01_00259888 predicted 698
10 SASI_Mm01_00259889 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259622 predicted 1594
2 SASI_Mm01_00259623 predicted 1196
3 SASI_Mm01_00259624 predicted 1561
4 SASI_Mm01_00259625 predicted 1480
5 SASI_Mm01_00259626 predicted 1369
6 SASI_Mm01_00259627 predicted 1393
7 SASI_Mm01_00259628 predicted 1316
8 SASI_Mm01_00259629 predicted 1483
9 SASI_Mm01_00259630 predicted 1217
10 SASI_Mm01_00259631 predicted 1616
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_991692 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218450 predicted 1593
2 SASI_Mm01_00218451 predicted 1186
3 SASI_Mm01_00218452 predicted 1555
4 SASI_Mm01_00218453 predicted 1474
5 SASI_Mm01_00218454 predicted 1371
6 SASI_Mm01_00218455 predicted 1381
7 SASI_Mm01_00218456 predicted 1319
8 SASI_Mm01_00218457 predicted 1476
9 SASI_Mm01_00218458 predicted 1214
10 SASI_Mm01_00218459 predicted 1620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001011713
VALIDATED
NAA30 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 30, NatC catalytic subunit
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-1206s1c1
Sequence:CCGGGAGTTGATGCACTGCGACTTACTCGAGTAAGTCGCAGTGCATCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-953s1c1
Sequence:CCGGGCCATCGTTTGCAAGTTGGATCTCGAGATCCAACTTGCAAACGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-1180s1c1
Sequence:CCGGGAGGCTGTTCAGATACTATTTCTCGAGAAATAGTATCTGAACAGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-2741s1c1
Sequence:CCGGCCTCCATTAACAGTTGGTAAACTCGAGTTTACCAACTGTTAATGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-1044s1c1
Sequence:CCGGGCATTGGTACTAACTTGGTTACTCGAGTAACCAAGTTAGTACCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-993s1c1
Sequence:CCGGGCAGAGGTTATATAGCCATGTCTCGAGACATGGCTATATAACCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-1734s1c1
Sequence:CCGGCCTCAGTGATTAGTGAATGAACTCGAGTTCATTCACTAATCACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011713.1-1473s1c1
Sequence:CCGGGCCAGTTGATAGCCAAGATTTCTCGAGAAATCTTGGCTATCAACTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-826s1c1
Sequence:CCGGGCCCGATATCATGAGACTGATCTCGAGATCAGTCTCATGATATCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001011713.2-1555s21c1
Sequence:CCGGACCAGTAAGTGGAACATAATTCTCGAGAATTATGTTCCACTTACTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011713.2-1132s21c1
Sequence:CCGGTAAGTCCGCTTTGAAACTTTACTCGAGTAAAGTTTCAAAGCGGACTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011713.2-399s21c1
Sequence:CCGGAGCAGCTCAACGGATTGATTACTCGAGTAATCAATCCGTTGAGCTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001011713
VALIDATED
NAA30 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 30, NatC catalytic subunit
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-1206s1c1
Sequence:CCGGGAGTTGATGCACTGCGACTTACTCGAGTAAGTCGCAGTGCATCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-953s1c1
Sequence:CCGGGCCATCGTTTGCAAGTTGGATCTCGAGATCCAACTTGCAAACGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-1180s1c1
Sequence:CCGGGAGGCTGTTCAGATACTATTTCTCGAGAAATAGTATCTGAACAGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-2741s1c1
Sequence:CCGGCCTCCATTAACAGTTGGTAAACTCGAGTTTACCAACTGTTAATGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-1044s1c1
Sequence:CCGGGCATTGGTACTAACTTGGTTACTCGAGTAACCAAGTTAGTACCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-993s1c1
Sequence:CCGGGCAGAGGTTATATAGCCATGTCTCGAGACATGGCTATATAACCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-1734s1c1
Sequence:CCGGCCTCAGTGATTAGTGAATGAACTCGAGTTCATTCACTAATCACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011713.1-1473s1c1
Sequence:CCGGGCCAGTTGATAGCCAAGATTTCTCGAGAAATCTTGGCTATCAACTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-826s1c1
Sequence:CCGGGCCCGATATCATGAGACTGATCTCGAGATCAGTCTCATGATATCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000448003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001011713.2-1555s21c1
Sequence:CCGGACCAGTAAGTGGAACATAATTCTCGAGAATTATGTTCCACTTACTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011713.2-1132s21c1
Sequence:CCGGTAAGTCCGCTTTGAAACTTTACTCGAGTAAAGTTTCAAAGCGGACTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011713.2-399s21c1
Sequence:CCGGAGCAGCTCAACGGATTGATTACTCGAGTAATCAATCCGTTGAGCTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001011713
VALIDATED
NAA30 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 30, NatC catalytic subunit
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-1206s1c1
Sequence:CCGGGAGTTGATGCACTGCGACTTACTCGAGTAAGTCGCAGTGCATCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-953s1c1
Sequence:CCGGGCCATCGTTTGCAAGTTGGATCTCGAGATCCAACTTGCAAACGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-1180s1c1
Sequence:CCGGGAGGCTGTTCAGATACTATTTCTCGAGAAATAGTATCTGAACAGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-2741s1c1
Sequence:CCGGCCTCCATTAACAGTTGGTAAACTCGAGTTTACCAACTGTTAATGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-1044s1c1
Sequence:CCGGGCATTGGTACTAACTTGGTTACTCGAGTAACCAAGTTAGTACCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001011713.1-993s1c1
Sequence:CCGGGCAGAGGTTATATAGCCATGTCTCGAGACATGGCTATATAACCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-1734s1c1
Sequence:CCGGCCTCAGTGATTAGTGAATGAACTCGAGTTCATTCACTAATCACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001011713.1-1473s1c1
Sequence:CCGGGCCAGTTGATAGCCAAGATTTCTCGAGAAATCTTGGCTATCAACTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001011713.1-826s1c1
Sequence:CCGGGCCCGATATCATGAGACTGATCTCGAGATCAGTCTCATGATATCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000448003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001011713.2-1555s21c1
Sequence:CCGGACCAGTAAGTGGAACATAATTCTCGAGAATTATGTTCCACTTACTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011713.2-1132s21c1
Sequence:CCGGTAAGTCCGCTTTGAAACTTTACTCGAGTAAAGTTTCAAAGCGGACTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001011713.2-399s21c1
Sequence:CCGGAGCAGCTCAACGGATTGATTACTCGAGTAATCAATCCGTTGAGCTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081430
VALIDATED
NAA30 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 30, NatC catalytic subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081430.1-3852s21c1
Sequence:CCGGACTACTTAACTCGGGAATAATCTCGAGATTATTCCCGAGTTAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081430.1-871s21c1
Sequence:CCGGCCTACTCCATTTATACGTATACTCGAGTATACGTATAAATGGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081430.1-792s21c1
Sequence:CCGGACGATACGATACGTCCGATATCTCGAGATATCGGACGTATCGTATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081430.1-1217s21c1
Sequence:CCGGAGTTGACGCACTGCGACTTAACTCGAGTTAAGTCGCAGTGCGTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081430.1-995s21c1
Sequence:CCGGGATGTTCCGCAGAGGTTATATCTCGAGATATAACCTCTGCGGAACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081430
VALIDATED
NAA30 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 30, NatC catalytic subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081430.1-3852s21c1
Sequence:CCGGACTACTTAACTCGGGAATAATCTCGAGATTATTCCCGAGTTAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081430.1-871s21c1
Sequence:CCGGCCTACTCCATTTATACGTATACTCGAGTATACGTATAAATGGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081430.1-792s21c1
Sequence:CCGGACGATACGATACGTCCGATATCTCGAGATATCGGACGTATCGTATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081430.1-1217s21c1
Sequence:CCGGAGTTGACGCACTGCGACTTAACTCGAGTTAAGTCGCAGTGCGTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081430.1-995s21c1
Sequence:CCGGGATGTTCCGCAGAGGTTATATCTCGAGATATAACCTCTGCGGAACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081430
VALIDATED
NAA30 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 30, NatC catalytic subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081430.1-3852s21c1
Sequence:CCGGACTACTTAACTCGGGAATAATCTCGAGATTATTCCCGAGTTAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081430.1-871s21c1
Sequence:CCGGCCTACTCCATTTATACGTATACTCGAGTATACGTATAAATGGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081430.1-792s21c1
Sequence:CCGGACGATACGATACGTCCGATATCTCGAGATATCGGACGTATCGTATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081430.1-1217s21c1
Sequence:CCGGAGTTGACGCACTGCGACTTAACTCGAGTTAAGTCGCAGTGCGTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001081430.1-995s21c1
Sequence:CCGGGATGTTCCGCAGAGGTTATATCTCGAGATATAACCTCTGCGGAACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)