EMAIL THIS PAGE TO A FRIEND

NAA35

N(alpha)-acetyltransferase 35, NatC auxiliary subunit

67 Gene Product Result for
Synonyms: MAK10 bA379P1.1
UniProtKB ID: Q5VZE5, Q9H631, Q9H703
Gene ID:
Mouse(78689) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Rat(64472) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Zebrafish(321587) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
domestic cat(101083300) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
cow(506175) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Horse(100064899) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
dog(476304) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
chicken(427461) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
sheep(101115255) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
domestic guinea pig(100726315) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
naked mole-rat(101708613) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Domestic Rabbit(100358576) N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030153 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030153 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030153 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024635 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024635 Rosetta Predictions human pricing
NM_133324 Rosetta Predictions rat pricing
NM_030153 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087040 predicted 926
2 SASI_Hs01_00087041 predicted 1118
3 SASI_Hs01_00087042 predicted 360
4 SASI_Hs02_00357014 predicted 1286
5 SASI_Hs02_00357015 predicted 1574
6 SASI_Hs01_00087044 predicted 1476
7 SASI_Hs01_00087045 predicted 835
8 SASI_Hs01_00087047 predicted 1014
9 SASI_Hs02_00357016 predicted 489
10 SASI_Hs02_00357017 predicted 337
11 SASI_Hs01_00087043 predicted 457
12 SASI_Hs01_00087046 predicted 1576
13 SASI_Hs01_00087048 predicted 873
14 SASI_Hs01_00087049 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030308 predicted 378
2 SASI_Rn01_00030309 predicted 1037
3 SASI_Rn01_00030310 predicted 2152
4 SASI_Rn02_00267633 predicted 673
5 SASI_Rn01_00030311 predicted 940
6 SASI_Rn01_00030312 predicted 1837
7 SASI_Rn01_00030313 predicted 795
8 SASI_Rn01_00030314 predicted 1394
9 SASI_Rn01_00030315 predicted 2147
10 SASI_Rn02_00267634 predicted 2226
11 SASI_Rn01_00030316 predicted 332
12 SASI_Rn01_00030317 predicted 1518
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030153 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125334 predicted 511
2 SASI_Mm01_00125335 predicted 1103
3 SASI_Mm02_00336565 predicted 2217
4 SASI_Mm01_00125336 predicted 1011
5 SASI_Mm01_00125337 predicted 870
6 SASI_Mm01_00125338 predicted 1521
7 SASI_Mm02_00336566 predicted 1119
8 SASI_Mm01_00125339 predicted 782
9 SASI_Mm01_00125341 predicted 1534
10 SASI_Mm01_00125342 predicted 1487
11 SASI_Mm01_00125340 predicted 625
12 SASI_Mm01_00125343 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030153
VALIDATED
NAA35 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-1593s1c1
Sequence:CCGGCTTAGGAACCTGGGTTCTTTACTCGAGTAAAGAACCCAGGTTCCTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.1-1463s1c1
Sequence:CCGGCGCTTCATACTATGTTGTTGACTCGAGTCAACAACATAGTATGAAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-360s1c1
Sequence:CCGGGCCTGAACTGATAGGAATAATCTCGAGATTATTCCTATCAGTTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-1078s1c1
Sequence:CCGGGTCGTGAACTTACCAAACTTACTCGAGTAAGTTTGGTAAGTTCACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-1599s1c1
Sequence:CCGGGCATGAGTACTACTACATCTACTCGAGTAGATGTAGTAGTACTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-1097s1c1
Sequence:CCGGGAGAAGAAATGGTCAACTATTCTCGAGAATAGTTGACCATTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-660s1c1
Sequence:CCGGGTCAATGACATACGGATTTAACTCGAGTTAAATCCGTATGTCATTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-2266s1c1
Sequence:CCGGGACTTCTCTGTTCACAAATATCTCGAGATATTTGTGAACAGAGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-2291s1c1
Sequence:CCGGGTGACAGAAAGTGGATCTCTTCTCGAGAAGAGATCCACTTTCTGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.1-933s1c1
Sequence:CCGGCCATCCAATTATGATGGGTTTCTCGAGAAACCCATCATAATTGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030153
VALIDATED
NAA35 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-1593s1c1
Sequence:CCGGCTTAGGAACCTGGGTTCTTTACTCGAGTAAAGAACCCAGGTTCCTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.1-1463s1c1
Sequence:CCGGCGCTTCATACTATGTTGTTGACTCGAGTCAACAACATAGTATGAAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-360s1c1
Sequence:CCGGGCCTGAACTGATAGGAATAATCTCGAGATTATTCCTATCAGTTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-1078s1c1
Sequence:CCGGGTCGTGAACTTACCAAACTTACTCGAGTAAGTTTGGTAAGTTCACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-1599s1c1
Sequence:CCGGGCATGAGTACTACTACATCTACTCGAGTAGATGTAGTAGTACTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-1097s1c1
Sequence:CCGGGAGAAGAAATGGTCAACTATTCTCGAGAATAGTTGACCATTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-660s1c1
Sequence:CCGGGTCAATGACATACGGATTTAACTCGAGTTAAATCCGTATGTCATTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-2266s1c1
Sequence:CCGGGACTTCTCTGTTCACAAATATCTCGAGATATTTGTGAACAGAGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-2291s1c1
Sequence:CCGGGTGACAGAAAGTGGATCTCTTCTCGAGAAGAGATCCACTTTCTGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.1-933s1c1
Sequence:CCGGCCATCCAATTATGATGGGTTTCTCGAGAAACCCATCATAATTGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030153
VALIDATED
NAA35 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-1593s1c1
Sequence:CCGGCTTAGGAACCTGGGTTCTTTACTCGAGTAAAGAACCCAGGTTCCTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.1-1463s1c1
Sequence:CCGGCGCTTCATACTATGTTGTTGACTCGAGTCAACAACATAGTATGAAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-360s1c1
Sequence:CCGGGCCTGAACTGATAGGAATAATCTCGAGATTATTCCTATCAGTTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-1078s1c1
Sequence:CCGGGTCGTGAACTTACCAAACTTACTCGAGTAAGTTTGGTAAGTTCACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-1599s1c1
Sequence:CCGGGCATGAGTACTACTACATCTACTCGAGTAGATGTAGTAGTACTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-1097s1c1
Sequence:CCGGGAGAAGAAATGGTCAACTATTCTCGAGAATAGTTGACCATTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-660s1c1
Sequence:CCGGGTCAATGACATACGGATTTAACTCGAGTTAAATCCGTATGTCATTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.2-2266s1c1
Sequence:CCGGGACTTCTCTGTTCACAAATATCTCGAGATATTTGTGAACAGAGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181510    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_030153.1-2291s1c1
Sequence:CCGGGTGACAGAAAGTGGATCTCTTCTCGAGAAGAGATCCACTTTCTGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030153.1-933s1c1
Sequence:CCGGCCATCCAATTATGATGGGTTTCTCGAGAAACCCATCATAATTGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024635
VALIDATED
NAA35 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-1916s1c1
Sequence:CCGGGCATTTGACATGGACGGCAAACTCGAGTTTGCCGTCCATGTCAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-2508s1c1
Sequence:CCGGCCATGGAAGAAACTGGTCTTACTCGAGTAAGACCAGTTTCTTCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024635.2-2406s1c1
Sequence:CCGGGATGGATTTCTTGGGTAACAACTCGAGTTGTTACCCAAGAAATCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-347s1c1
Sequence:CCGGGCTGGCATGATTGGAAACCAACTCGAGTTGGTTTCCAATCATGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-1625s1c1
Sequence:CCGGCGCATTATGATACAGTACCTTCTCGAGAAGGTACTGTATCATAATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-514s1c1
Sequence:CCGGGACAGTATTTACGTGCCTTTACTCGAGTAAAGGCACGTAAATACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-2453s1c1
Sequence:CCGGGACAGCCTTATATGACATGAACTCGAGTTCATGTCATATAAGGCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024635.2-2194s1c1
Sequence:CCGGCAAACCCAACTTTGTGGTTATCTCGAGATAACCACAAAGTTGGGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024635.2-254s1c1
Sequence:CCGGCGAGAATTAAAGTTGGGAGAACTCGAGTTCTCCCAACTTTAATTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-2402s1c1
Sequence:CCGGGTGAGATGGATTTCTTGGGTACTCGAGTACCCAAGAAATCCATCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024635
VALIDATED
NAA35 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-1916s1c1
Sequence:CCGGGCATTTGACATGGACGGCAAACTCGAGTTTGCCGTCCATGTCAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-2508s1c1
Sequence:CCGGCCATGGAAGAAACTGGTCTTACTCGAGTAAGACCAGTTTCTTCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024635.2-2406s1c1
Sequence:CCGGGATGGATTTCTTGGGTAACAACTCGAGTTGTTACCCAAGAAATCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-347s1c1
Sequence:CCGGGCTGGCATGATTGGAAACCAACTCGAGTTGGTTTCCAATCATGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-1625s1c1
Sequence:CCGGCGCATTATGATACAGTACCTTCTCGAGAAGGTACTGTATCATAATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-514s1c1
Sequence:CCGGGACAGTATTTACGTGCCTTTACTCGAGTAAAGGCACGTAAATACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-2453s1c1
Sequence:CCGGGACAGCCTTATATGACATGAACTCGAGTTCATGTCATATAAGGCTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024635.2-2194s1c1
Sequence:CCGGCAAACCCAACTTTGTGGTTATCTCGAGATAACCACAAAGTTGGGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024635.2-254s1c1
Sequence:CCGGCGAGAATTAAAGTTGGGAGAACTCGAGTTCTCCCAACTTTAATTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-2402s1c1
Sequence:CCGGGTGAGATGGATTTCTTGGGTACTCGAGTACCCAAGAAATCCATCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024635
VALIDATED
NAA35 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 35, NatC auxiliary subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-1916s1c1
Sequence:CCGGGCATTTGACATGGACGGCAAACTCGAGTTTGCCGTCCATGTCAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136797    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-2508s1c1
Sequence:CCGGCCATGGAAGAAACTGGTCTTACTCGAGTAAGACCAGTTTCTTCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135379    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024635.2-2406s1c1
Sequence:CCGGGATGGATTTCTTGGGTAACAACTCGAGTTGTTACCCAAGAAATCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138127    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-347s1c1
Sequence:CCGGGCTGGCATGATTGGAAACCAACTCGAGTTGGTTTCCAATCATGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-1625s1c1
Sequence:CCGGCGCATTATGATACAGTACCTTCTCGAGAAGGTACTGTATCATAATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-514s1c1
Sequence:CCGGGACAGTATTTACGTGCCTTTACTCGAGTAAAGGCACGTAAATACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-2453s1c1
Sequence:CCGGGACAGCCTTATATGACATGAACTCGAGTTCATGTCATATAAGGCTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024635.2-2194s1c1
Sequence:CCGGCAAACCCAACTTTGTGGTTATCTCGAGATAACCACAAAGTTGGGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024635.2-254s1c1
Sequence:CCGGCGAGAATTAAAGTTGGGAGAACTCGAGTTCTCCCAACTTTAATTCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137333    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_024635.2-2402s1c1
Sequence:CCGGGTGAGATGGATTTCTTGGGTACTCGAGTACCCAAGAAATCCATCTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)