EMAIL THIS PAGE TO A FRIEND

NAA38

N(alpha)-acetyltransferase 38, NatC auxiliary subunit

60 Gene Product Result for
Synonyms: LSM8
UniProtKB ID: O95777
Gene ID:
Human(51691) Summary: This gene encodes a member of the like-Sm family of proteins. The encoded protein consists of a closed barrel shape, made up of five anti-parallel beta strands and an alpha helix. This protein partners with six paralogs to form a heteroheptameric ring which transiently binds U6 small nuclear RNAs and is involved in the general maturation of RNA in the nucleus. [provided by RefSeq, Jan 2010]
Mouse(76522) N(alpha)-acetyltransferase 38, NatC auxiliary subunit
Rat(296913) N(alpha)-acetyltransferase 38, NatC auxiliary subunit
domestic guinea pig(100720171) N(alpha)-acetyltransferase 38, NatC auxiliary subunit
sheep(101102229) N(alpha)-acetyltransferase 38, NatC auxiliary subunit
chicken(417765) N(alpha)-acetyltransferase 38, NatC auxiliary subunit
dog(475298) N(alpha)-acetyltransferase 38, NatC auxiliary subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133939 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133939 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133939 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016200 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016200 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016200 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016200 Rosetta Predictions human pricing
NM_001106585 Rosetta Predictions rat pricing
NM_133939 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016200 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156688 predicted 213
2 SASI_Hs01_00156689 predicted 296
3 SASI_Hs01_00156690 predicted 252
4 SASI_Hs01_00156691 predicted 921
5 SASI_Hs01_00156693 predicted 309
6 SASI_Hs01_00156694 predicted 962
7 SASI_Hs02_00349034 predicted 217
8 SASI_Hs02_00349035 predicted 909
9 SASI_Hs02_00349036 predicted 310
10 SASI_Hs02_00349037 predicted 343
11 SASI_Hs01_00156687 predicted 943
12 SASI_Hs01_00156692 predicted 236
13 SASI_Hs01_00156695 predicted 352
14 SASI_Hs01_00156696 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220398 predicted 545
2 SASI_Rn02_00220399 predicted 206
3 SASI_Rn02_00220400 predicted 420
4 SASI_Rn02_00220401 predicted 455
5 SASI_Rn02_00220402 predicted 479
6 SASI_Rn02_00220403 predicted 465
7 SASI_Rn02_00220404 predicted 541
8 SASI_Rn02_00220405 predicted 312
9 SASI_Rn02_00220406 predicted 325
10 SASI_Rn02_00220407 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133939 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126539 predicted 487
2 SASI_Mm01_00126540 predicted 493
3 SASI_Mm01_00126541 predicted 390
4 SASI_Mm01_00126543 predicted 213
5 SASI_Mm02_00339038 predicted 375
6 SASI_Mm01_00126544 predicted 435
7 SASI_Mm01_00126545 predicted 468
8 SASI_Mm01_00126546 predicted 466
9 SASI_Mm01_00126547 predicted 365
10 SASI_Mm01_00126548 predicted 429
11 SASI_Mm01_00126542 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133939
VALIDATED
NAA38 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 38, NatC auxiliary subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133939.1-467s1c1
Sequence:CCGGGAGTGTGTAATTGTGCAGTTTCTCGAGAAACTGCACAATTACACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133939.1-390s1c1
Sequence:CCGGGACCTCAGTGTGTAGTGAGATCTCGAGATCTCACTACACACTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133939.1-160s1c1
Sequence:CCGGGAATGATTGTGGGAACACTAACTCGAGTTAGTGTTCCCACAATCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133939.1-135s1c1
Sequence:CCGGGTGGCTGTTATTACTTCTGATCTCGAGATCAGAAGTAATAACAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133939.1-189s1c1
Sequence:CCGGGACCAGACCATTAACTTGATTCTCGAGAATCAAGTTAATGGTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133939.1-189s21c1
Sequence:CCGGGACCAGACCATTAACTTGATTCTCGAGAATCAAGTTAATGGTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133939.1-390s21c1
Sequence:CCGGGACCTCAGTGTGTAGTGAGATCTCGAGATCTCACTACACACTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133939.1-135s21c1
Sequence:CCGGGTGGCTGTTATTACTTCTGATCTCGAGATCAGAAGTAATAACAGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133939.1-160s21c1
Sequence:CCGGGAATGATTGTGGGAACACTAACTCGAGTTAGTGTTCCCACAATCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133939.1-467s21c1
Sequence:CCGGGAGTGTGTAATTGTGCAGTTTCTCGAGAAACTGCACAATTACACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133939
VALIDATED
NAA38 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 38, NatC auxiliary subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133939.1-467s1c1
Sequence:CCGGGAGTGTGTAATTGTGCAGTTTCTCGAGAAACTGCACAATTACACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133939.1-390s1c1
Sequence:CCGGGACCTCAGTGTGTAGTGAGATCTCGAGATCTCACTACACACTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133939.1-160s1c1
Sequence:CCGGGAATGATTGTGGGAACACTAACTCGAGTTAGTGTTCCCACAATCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133939.1-135s1c1
Sequence:CCGGGTGGCTGTTATTACTTCTGATCTCGAGATCAGAAGTAATAACAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133939.1-189s1c1
Sequence:CCGGGACCAGACCATTAACTTGATTCTCGAGAATCAAGTTAATGGTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133939.1-189s21c1
Sequence:CCGGGACCAGACCATTAACTTGATTCTCGAGAATCAAGTTAATGGTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133939.1-390s21c1
Sequence:CCGGGACCTCAGTGTGTAGTGAGATCTCGAGATCTCACTACACACTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133939.1-135s21c1
Sequence:CCGGGTGGCTGTTATTACTTCTGATCTCGAGATCAGAAGTAATAACAGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133939.1-160s21c1
Sequence:CCGGGAATGATTGTGGGAACACTAACTCGAGTTAGTGTTCCCACAATCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133939.1-467s21c1
Sequence:CCGGGAGTGTGTAATTGTGCAGTTTCTCGAGAAACTGCACAATTACACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133939
VALIDATED
NAA38 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 38, NatC auxiliary subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133939.1-467s1c1
Sequence:CCGGGAGTGTGTAATTGTGCAGTTTCTCGAGAAACTGCACAATTACACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133939.1-390s1c1
Sequence:CCGGGACCTCAGTGTGTAGTGAGATCTCGAGATCTCACTACACACTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133939.1-160s1c1
Sequence:CCGGGAATGATTGTGGGAACACTAACTCGAGTTAGTGTTCCCACAATCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133939.1-135s1c1
Sequence:CCGGGTGGCTGTTATTACTTCTGATCTCGAGATCAGAAGTAATAACAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133939.1-189s1c1
Sequence:CCGGGACCAGACCATTAACTTGATTCTCGAGAATCAAGTTAATGGTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133939.1-189s21c1
Sequence:CCGGGACCAGACCATTAACTTGATTCTCGAGAATCAAGTTAATGGTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133939.1-390s21c1
Sequence:CCGGGACCTCAGTGTGTAGTGAGATCTCGAGATCTCACTACACACTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133939.1-135s21c1
Sequence:CCGGGTGGCTGTTATTACTTCTGATCTCGAGATCAGAAGTAATAACAGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133939.1-160s21c1
Sequence:CCGGGAATGATTGTGGGAACACTAACTCGAGTTAGTGTTCCCACAATCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316273    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133939.1-467s21c1
Sequence:CCGGGAGTGTGTAATTGTGCAGTTTCTCGAGAAACTGCACAATTACACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016200
VALIDATED
NAA38 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 38, NatC auxiliary subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016200.2-768s1c1
Sequence:CCGGGCTGGAGTTATCTGAATCATTCTCGAGAATGATTCAGATAACTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016200.2-219s1c1
Sequence:CCGGGAACAAGTGGTACTAGGATTACTCGAGTAATCCTAGTACCACTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016200.2-324s1c1
Sequence:CCGGGCAGAACCTTTAAATTCTGTACTCGAGTACAGAATTTAAAGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016200.2-179s1c1
Sequence:CCGGTGAAAGCCATGAACGAGTATTCTCGAGAATACTCGTTCATGGCTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016200.2-99s1c1
Sequence:CCGGGTTGCCGTTATTACATCAGATCTCGAGATCTGATGTAATAACGGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016200.3-928s21c1
Sequence:CCGGGATTCCACTGGTGGTAGTTTGCTCGAGCAAACTACCACCAGTGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-390s21c1
Sequence:CCGGCGTTGCAGTCATTGGAGAAATCTCGAGATTTCTCCAATGACTGCAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-349s21c1
Sequence:CCGGGAACAAGTGGTACTAGGATTACTCGAGTAATCCTAGTACCACTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-454s21c1
Sequence:CCGGGCAGAACCTTTAAATTCTGTACTCGAGTACAGAATTTAAAGGTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-280s21c1
Sequence:CCGGTTTGACCAGACCATTAATTTGCTCGAGCAAATTAATGGTCTGGTCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016200
VALIDATED
NAA38 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 38, NatC auxiliary subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016200.2-768s1c1
Sequence:CCGGGCTGGAGTTATCTGAATCATTCTCGAGAATGATTCAGATAACTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016200.2-219s1c1
Sequence:CCGGGAACAAGTGGTACTAGGATTACTCGAGTAATCCTAGTACCACTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016200.2-324s1c1
Sequence:CCGGGCAGAACCTTTAAATTCTGTACTCGAGTACAGAATTTAAAGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016200.2-179s1c1
Sequence:CCGGTGAAAGCCATGAACGAGTATTCTCGAGAATACTCGTTCATGGCTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016200.2-99s1c1
Sequence:CCGGGTTGCCGTTATTACATCAGATCTCGAGATCTGATGTAATAACGGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016200.3-928s21c1
Sequence:CCGGGATTCCACTGGTGGTAGTTTGCTCGAGCAAACTACCACCAGTGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-390s21c1
Sequence:CCGGCGTTGCAGTCATTGGAGAAATCTCGAGATTTCTCCAATGACTGCAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-349s21c1
Sequence:CCGGGAACAAGTGGTACTAGGATTACTCGAGTAATCCTAGTACCACTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-454s21c1
Sequence:CCGGGCAGAACCTTTAAATTCTGTACTCGAGTACAGAATTTAAAGGTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-280s21c1
Sequence:CCGGTTTGACCAGACCATTAATTTGCTCGAGCAAATTAATGGTCTGGTCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016200
VALIDATED
NAA38 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 38, NatC auxiliary subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074758    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016200.2-768s1c1
Sequence:CCGGGCTGGAGTTATCTGAATCATTCTCGAGAATGATTCAGATAACTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_016200.2-219s1c1
Sequence:CCGGGAACAAGTGGTACTAGGATTACTCGAGTAATCCTAGTACCACTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016200.2-324s1c1
Sequence:CCGGGCAGAACCTTTAAATTCTGTACTCGAGTACAGAATTTAAAGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016200.2-179s1c1
Sequence:CCGGTGAAAGCCATGAACGAGTATTCTCGAGAATACTCGTTCATGGCTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016200.2-99s1c1
Sequence:CCGGGTTGCCGTTATTACATCAGATCTCGAGATCTGATGTAATAACGGCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308086    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016200.3-928s21c1
Sequence:CCGGGATTCCACTGGTGGTAGTTTGCTCGAGCAAACTACCACCAGTGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-390s21c1
Sequence:CCGGCGTTGCAGTCATTGGAGAAATCTCGAGATTTCTCCAATGACTGCAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-349s21c1
Sequence:CCGGGAACAAGTGGTACTAGGATTACTCGAGTAATCCTAGTACCACTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-454s21c1
Sequence:CCGGGCAGAACCTTTAAATTCTGTACTCGAGTACAGAATTTAAAGGTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_016200.3-280s21c1
Sequence:CCGGTTTGACCAGACCATTAATTTGCTCGAGCAAATTAATGGTCTGGTCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)