EMAIL THIS PAGE TO A FRIEND

NAA40

N(alpha)-acetyltransferase 40, NatD catalytic subunit

136 Gene Product Result for
Synonyms: NAT11 PATT1
UniProtKB ID: Q86UY6, Q5HYL5, Q9H897
Gene ID:
Mouse(70999) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
Rat(361718) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
Zebrafish(550325) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
cow(517933) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
domestic cat(101096166) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
dog(476041) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
chicken(430563) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
sheep(101121556) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
domestic guinea pig(100735089) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
naked mole-rat(101707230) N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024771 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024771 Rosetta Predictions human pricing
NM_001108518 Rosetta Predictions rat pricing
XM_001473047 Rosetta Predictions mouse pricing
XM_001473067 Rosetta Predictions mouse pricing
XM_885052 Rosetta Predictions mouse pricing
XM_895976 Rosetta Predictions mouse pricing
XM_895985 Rosetta Predictions mouse pricing
XM_895992 Rosetta Predictions mouse pricing
XM_895998 Rosetta Predictions mouse pricing
XM_896003 Rosetta Predictions mouse pricing
XM_912399 Rosetta Predictions mouse pricing
XM_922382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186205 predicted 1175
2 SASI_Hs01_00186206 predicted 377
3 SASI_Hs01_00186207 predicted 504
4 SASI_Hs01_00186208 predicted 707
5 SASI_Hs01_00186209 predicted 587
6 SASI_Hs01_00186210 predicted 601
7 SASI_Hs01_00186211 predicted 1000
8 SASI_Hs01_00186212 predicted 602
9 SASI_Hs01_00186213 predicted 1162
10 SASI_Hs01_00186214 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239439 predicted 950
2 SASI_Rn02_00239440 predicted 472
3 SASI_Rn02_00239441 predicted 643
4 SASI_Rn02_00239442 predicted 689
5 SASI_Rn02_00239443 predicted 1296
6 SASI_Rn02_00239444 predicted 1396
7 SASI_Rn02_00239445 predicted 396
8 SASI_Rn02_00239446 predicted 1285
9 SASI_Rn02_00239447 predicted 395
10 SASI_Rn02_00239448 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473047 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00365587 predicted 1322
2 SASI_Mm02_00365588 predicted 855
3 SASI_Mm02_00365589 predicted 1194
4 SASI_Mm02_00365590 predicted 1332
5 SASI_Mm02_00365591 predicted 1454
6 SASI_Mm02_00365592 predicted 1026
7 SASI_Mm02_00365593 predicted 1434
8 SASI_Mm02_00365594 predicted 1285
9 SASI_Mm02_00365595 predicted 1403
10 SASI_Mm02_00365596 predicted 956
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00365719 predicted 1125
2 SASI_Mm02_00365720 predicted 666
3 SASI_Mm02_00365721 predicted 1003
4 SASI_Mm02_00365722 predicted 1138
5 SASI_Mm02_00365723 predicted 1258
6 SASI_Mm02_00365724 predicted 832
7 SASI_Mm02_00365725 predicted 1245
8 SASI_Mm02_00365726 predicted 1088
9 SASI_Mm02_00365727 predicted 1203
10 SASI_Mm02_00365728 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885052 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229551 predicted 1356
2 SASI_Mm01_00229552 predicted 989
3 SASI_Mm01_00229553 predicted 1240
4 SASI_Mm01_00229554 predicted 1372
5 SASI_Mm01_00229555 predicted 1487
6 SASI_Mm01_00229556 predicted 1472
7 SASI_Mm01_00229557 predicted 1319
8 SASI_Mm01_00229558 predicted 1110
9 SASI_Mm01_00229559 predicted 1444
10 SASI_Mm01_00229560 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895976 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229408 predicted 547
2 SASI_Mm01_00229409 predicted 552
3 SASI_Mm01_00229410 predicted 516
4 SASI_Mm01_00229411 predicted 544
5 SASI_Mm01_00229412 predicted 513
6 SASI_Mm01_00229413 predicted 563
7 SASI_Mm01_00229414 predicted 529
8 SASI_Mm01_00229415 predicted 555
9 SASI_Mm01_00229416 predicted 552
10 SASI_Mm01_00229417 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895985 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234575 predicted 1252
2 SASI_Mm01_00234576 predicted 520
3 SASI_Mm01_00234577 predicted 522
4 SASI_Mm01_00234578 predicted 433
5 SASI_Mm01_00234579 predicted 1114
6 SASI_Mm01_00234580 predicted 290
7 SASI_Mm01_00234581 predicted 828
8 SASI_Mm01_00234582 predicted 577
9 SASI_Mm01_00234583 predicted 677
10 SASI_Mm01_00234584 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236862 predicted 2261
2 SASI_Mm01_00236863 predicted 1892
3 SASI_Mm01_00236864 predicted 2147
4 SASI_Mm01_00236865 predicted 2272
5 SASI_Mm01_00236866 predicted 2397
6 SASI_Mm01_00236867 predicted 2384
7 SASI_Mm01_00236868 predicted 2221
8 SASI_Mm01_00236869 predicted 2015
9 SASI_Mm01_00236870 predicted 2346
10 SASI_Mm01_00236871 predicted 1897
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895998 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00281697 predicted 1146
2 SASI_Mm01_00281698 predicted 781
3 SASI_Mm01_00281699 predicted 1029
4 SASI_Mm01_00281700 predicted 1160
5 SASI_Mm01_00281701 predicted 1278
6 SASI_Mm01_00281702 predicted 1260
7 SASI_Mm01_00281703 predicted 1112
8 SASI_Mm01_00281704 predicted 906
9 SASI_Mm01_00281705 predicted 1231
10 SASI_Mm01_00281706 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00222886 predicted 1194
2 SASI_Mm01_00222887 predicted 831
3 SASI_Mm01_00222888 predicted 1076
4 SASI_Mm01_00222889 predicted 1214
5 SASI_Mm01_00222890 predicted 1327
6 SASI_Mm01_00222891 predicted 1319
7 SASI_Mm01_00222892 predicted 1164
8 SASI_Mm01_00222893 predicted 955
9 SASI_Mm01_00222894 predicted 1281
10 SASI_Mm01_00222895 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00437036 predicted 1316
2 SASI_Mm02_00437037 predicted 1333
3 SASI_Mm02_00437038 predicted 488
4 SASI_Mm02_00437039 predicted 564
5 SASI_Mm02_00437040 predicted 697
6 SASI_Mm02_00437041 predicted 858
7 SASI_Mm02_00437042 predicted 1455
8 SASI_Mm02_00437043 predicted 1027
9 SASI_Mm02_00437044 predicted 1439
10 SASI_Mm02_00437045 predicted 782
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443396 predicted 1129
2 SASI_Mm02_00443397 predicted 1132
3 SASI_Mm02_00443398 predicted 495
4 SASI_Mm02_00443399 predicted 664
5 SASI_Mm02_00443400 predicted 1182
6 SASI_Mm02_00443401 predicted 1257
7 SASI_Mm02_00443402 predicted 833
8 SASI_Mm02_00443403 predicted 1237
9 SASI_Mm02_00443404 predicted 439
10 SASI_Mm02_00443405 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027643
VALIDATED
NAA40 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 40, NatD catalytic subunit
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000346851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027643.1-515s21c1
Sequence:CCGGCCAATATGCAGACGATGTATGCTCGAGCATACATCGTCTGCATATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027643.1-422s21c1
Sequence:CCGGATGACCGCAATGGGTTGAATGCTCGAGCATTCAACCCATTGCGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027643.1-1357s21c1
Sequence:CCGGGGACAAATGGAATGTTGTTAACTCGAGTTAACAACATTCCATTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027643
VALIDATED
NAA40 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 40, NatD catalytic subunit
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000346851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027643.1-515s21c1
Sequence:CCGGCCAATATGCAGACGATGTATGCTCGAGCATACATCGTCTGCATATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027643.1-422s21c1
Sequence:CCGGATGACCGCAATGGGTTGAATGCTCGAGCATTCAACCCATTGCGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027643.1-1357s21c1
Sequence:CCGGGGACAAATGGAATGTTGTTAACTCGAGTTAACAACATTCCATTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027643
VALIDATED
NAA40 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 40, NatD catalytic subunit
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000346851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027643.1-515s21c1
Sequence:CCGGCCAATATGCAGACGATGTATGCTCGAGCATACATCGTCTGCATATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027643.1-422s21c1
Sequence:CCGGATGACCGCAATGGGTTGAATGCTCGAGCATTCAACCCATTGCGGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346853    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_027643.1-1357s21c1
Sequence:CCGGGGACAAATGGAATGTTGTTAACTCGAGTTAACAACATTCCATTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024771
VALIDATED
NAA40 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 40, NatD catalytic subunit
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024771.2-626s21c1
Sequence:CCGGCAGATGAAGAAGGTTATGTTACTCGAGTAACATAACCTTCTTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024771.2-270s21c1
Sequence:CCGGATGATAGAAACGGGTTGAATGCTCGAGCATTCAACCCGTTTCTATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024771.2-1338s21c1
Sequence:CCGGCGCAGTTGGAATTGCTGTTAACTCGAGTTAACAGCAATTCCAACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024771.2-409s21c1
Sequence:CCGGCCGAGAGAAACGGGAGGAAATCTCGAGATTTCCTCCCGTTTCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024771.2-689s21c1
Sequence:CCGGGAAGCGTTGCAATTTGAAATTCTCGAGAATTTCAAATTGCAACGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-640s1c1
Sequence:CCGGGCCTACCAGTTCTTCAGAGAACTCGAGTTCTCTGAAGAACTGGTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-1613s1c1
Sequence:CCGGCCAGAGGTTCTGCTTGTTCTTCTCGAGAAGAACAAGCAGAACCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-1307s1c1
Sequence:CCGGCGCAGTTGGAATTGCTGTTAACTCGAGTTAACAGCAATTCCAACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-506s1c1
Sequence:CCGGGCTATGAAGTGCAGTTGGAAACTCGAGTTTCCAACTGCACTTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024771.1-234s1c1
Sequence:CCGGGAAATATGATAGAAACGGGTTCTCGAGAACCCGTTTCTATCATATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_024771.1-661s1c1
Sequence:CCGGGCGTTGCAATTTGAAATTGATCTCGAGATCAATTTCAAATTGCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024771.1-658s1c1
Sequence:CCGGGAAGCGTTGCAATTTGAAATTCTCGAGAATTTCAAATTGCAACGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024771.1-595s1c1
Sequence:CCGGCAGATGAAGAAGGTTATGTTACTCGAGTAACATAACCTTCTTCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-2145s1c1
Sequence:CCGGGCCAAATCCTTATCAAGGAAACTCGAGTTTCCTTGATAAGGATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-591s1c1
Sequence:CCGGCACACAGATGAAGAAGGTTATCTCGAGATAACCTTCTTCATCTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-493s1c1
Sequence:CCGGGAAGTCCTGTACTGCTATGAACTCGAGTTCATAGCAGTACAGGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-501s1c1
Sequence:CCGGGTACTGCTATGAAGTGCAGTTCTCGAGAACTGCACTTCATAGCAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024771
VALIDATED
NAA40 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 40, NatD catalytic subunit
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024771.2-626s21c1
Sequence:CCGGCAGATGAAGAAGGTTATGTTACTCGAGTAACATAACCTTCTTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024771.2-270s21c1
Sequence:CCGGATGATAGAAACGGGTTGAATGCTCGAGCATTCAACCCGTTTCTATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024771.2-1338s21c1
Sequence:CCGGCGCAGTTGGAATTGCTGTTAACTCGAGTTAACAGCAATTCCAACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024771.2-409s21c1
Sequence:CCGGCCGAGAGAAACGGGAGGAAATCTCGAGATTTCCTCCCGTTTCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000338610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024771.2-689s21c1
Sequence:CCGGGAAGCGTTGCAATTTGAAATTCTCGAGAATTTCAAATTGCAACGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-640s1c1
Sequence:CCGGGCCTACCAGTTCTTCAGAGAACTCGAGTTCTCTGAAGAACTGGTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-1613s1c1
Sequence:CCGGCCAGAGGTTCTGCTTGTTCTTCTCGAGAAGAACAAGCAGAACCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-1307s1c1
Sequence:CCGGCGCAGTTGGAATTGCTGTTAACTCGAGTTAACAGCAATTCCAACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-506s1c1
Sequence:CCGGGCTATGAAGTGCAGTTGGAAACTCGAGTTTCCAACTGCACTTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024771.1-234s1c1
Sequence:CCGGGAAATATGATAGAAACGGGTTCTCGAGAACCCGTTTCTATCATATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_024771.1-661s1c1
Sequence:CCGGGCGTTGCAATTTGAAATTGATCTCGAGATCAATTTCAAATTGCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024771.1-658s1c1
Sequence:CCGGGAAGCGTTGCAATTTGAAATTCTCGAGAATTTCAAATTGCAACGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024771.1-595s1c1
Sequence:CCGGCAGATGAAGAAGGTTATGTTACTCGAGTAACATAACCTTCTTCATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-2145s1c1
Sequence:CCGGGCCAAATCCTTATCAAGGAAACTCGAGTTTCCTTGATAAGGATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-591s1c1
Sequence:CCGGCACACAGATGAAGAAGGTTATCTCGAGATAACCTTCTTCATCTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-493s1c1
Sequence:CCGGGAAGTCCTGTACTGCTATGAACTCGAGTTCATAGCAGTACAGGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-501s1c1
Sequence:CCGGGTACTGCTATGAAGTGCAGTTCTCGAGAACTGCACTTCATAGCAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024771
VALIDATED
NAA40 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 40, NatD catalytic subunit
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024771.2-626s21c1
Sequence:CCGGCAGATGAAGAAGGTTATGTTACTCGAGTAACATAACCTTCTTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024771.2-270s21c1
Sequence:CCGGATGATAGAAACGGGTTGAATGCTCGAGCATTCAACCCGTTTCTATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338552    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_024771.2-1338s21c1
Sequence:CCGGCGCAGTTGGAATTGCTGTTAACTCGAGTTAACAGCAATTCCAACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024771.2-409s21c1
Sequence:CCGGCCGAGAGAAACGGGAGGAAATCTCGAGATTTCCTCCCGTTTCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000338610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_024771.2-689s21c1
Sequence:CCGGGAAGCGTTGCAATTTGAAATTCTCGAGAATTTCAAATTGCAACGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-640s1c1
Sequence:CCGGGCCTACCAGTTCTTCAGAGAACTCGAGTTCTCTGAAGAACTGGTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-1613s1c1
Sequence:CCGGCCAGAGGTTCTGCTTGTTCTTCTCGAGAAGAACAAGCAGAACCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-1307s1c1
Sequence:CCGGCGCAGTTGGAATTGCTGTTAACTCGAGTTAACAGCAATTCCAACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163802    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-506s1c1
Sequence:CCGGGCTATGAAGTGCAGTTGGAAACTCGAGTTTCCAACTGCACTTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024771.1-234s1c1
Sequence:CCGGGAAATATGATAGAAACGGGTTCTCGAGAACCCGTTTCTATCATATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_024771.1-661s1c1
Sequence:CCGGGCGTTGCAATTTGAAATTGATCTCGAGATCAATTTCAAATTGCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_024771.1-658s1c1
Sequence:CCGGGAAGCGTTGCAATTTGAAATTCTCGAGAATTTCAAATTGCAACGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_024771.1-595s1c1
Sequence:CCGGCAGATGAAGAAGGTTATGTTACTCGAGTAACATAACCTTCTTCATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024771.1-2145s1c1
Sequence:CCGGGCCAAATCCTTATCAAGGAAACTCGAGTTTCCTTGATAAGGATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-591s1c1
Sequence:CCGGCACACAGATGAAGAAGGTTATCTCGAGATAACCTTCTTCATCTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162977    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-493s1c1
Sequence:CCGGGAAGTCCTGTACTGCTATGAACTCGAGTTCATAGCAGTACAGGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024771.1-501s1c1
Sequence:CCGGGTACTGCTATGAAGTGCAGTTCTCGAGAACTGCACTTCATAGCAGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)