EMAIL THIS PAGE TO A FRIEND

NAA50

N(alpha)-acetyltransferase 50, NatE catalytic subunit

245 Gene Product Result for
Synonyms: MAK3 NAT13 NAT5 SAN hNAT5 hSAN
UniProtKB ID: Q9GZZ1, D3DN74, Q68DQ1
Gene ID:
Mouse(72117) N(alpha)-acetyltransferase 50, NatE catalytic subunit
Rat(288108) N(alpha)-acetyltransferase 50, NatE catalytic subunit
naked mole-rat(101717688) N(alpha)-acetyltransferase 50, NatE catalytic subunit
domestic guinea pig(100714668) N(alpha)-acetyltransferase 50, NatE catalytic subunit
Zebrafish(445229) N(alpha)-acetyltransferase 50, NatE catalytic subunit
chicken(418319) N(alpha)-acetyltransferase 50, NatE catalytic subunit
dog(478569) N(alpha)-acetyltransferase 50, NatE catalytic subunit
cow(517211) N(alpha)-acetyltransferase 50, NatE catalytic subunit
domestic cat(101091471) N(alpha)-acetyltransferase 50, NatE catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303764 ANTI-NAT13 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing
AV48934 Anti-NAT13 antibody produced in rabbit IgG fraction of antiserum human, rabbit, dog, bovine, pig, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028108 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028108 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028108 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025146 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025146 Rosetta Predictions human pricing
NM_001105881 Rosetta Predictions rat pricing
NM_028108 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245432 predicted 440
2 SASI_Hs01_00245433 predicted 504
3 SASI_Hs01_00245434 predicted 639
4 SASI_Hs01_00245436 predicted 1259
5 SASI_Hs01_00245437 predicted 1292
6 SASI_Hs02_00357877 predicted 1303
7 SASI_Hs02_00357878 predicted 379
8 SASI_Hs02_00357879 predicted 332
9 SASI_Hs01_00245439 predicted 353
10 SASI_Hs01_00245440 predicted 1223
11 SASI_Hs01_00245435 predicted 315
12 SASI_Hs01_00245438 predicted 328
13 SASI_Hs01_00245441 predicted 508
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105881 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213452 predicted 683
2 SASI_Rn02_00213453 predicted 582
3 SASI_Rn02_00213454 predicted 478
4 SASI_Rn02_00213455 predicted 790
5 SASI_Rn02_00213456 predicted 497
6 SASI_Rn02_00213457 predicted 961
7 SASI_Rn02_00213458 predicted 1283
8 SASI_Rn02_00213459 predicted 1007
9 SASI_Rn02_00213460 predicted 799
10 SASI_Rn02_00213461 predicted 661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028108 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090232 predicted 538
2 SASI_Mm01_00090233 predicted 1197
3 SASI_Mm01_00090234 predicted 503
4 SASI_Mm01_00090235 predicted 475
5 SASI_Mm02_00333351 predicted 1149
6 SASI_Mm01_00090236 predicted 528
7 SASI_Mm01_00090237 predicted 329
8 SASI_Mm01_00090238 predicted 349
9 SASI_Mm01_00090239 predicted 374
10 SASI_Mm01_00090240 predicted 1144
11 SASI_Mm01_00090241 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028108
VALIDATED
NAA50 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 50, NatE catalytic subunit
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028108.3-503s21c1
Sequence:CCGGAGACTTTACATCATGACACTACTCGAGTAGTGTCATGATGTAAAGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028108.2-688s1c1
Sequence:CCGGCGAGACAAAGAAGAACTACTACTCGAGTAGTAGTTCTTCTTTGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028108.2-374s1c1
Sequence:CCGGCCAGTCAGCTATAATGATAAACTCGAGTTTATCATTATAGCTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028108.2-675s1c1
Sequence:CCGGGCTTTGAGATTATCGAGACAACTCGAGTTGTCTCGATAATCTCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028108.2-536s1c1
Sequence:CCGGCCTTACCGAAGACTAGGAATACTCGAGTATTCCTAGTCTTCGGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028108.2-2943s1c1
Sequence:CCGGGCTCCCTATTATAGCTTCTTTCTCGAGAAAGAAGCTATAATAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028108.3-636s21c1
Sequence:CCGGTCAGCAATGAGTCAGCGATTGCTCGAGCAATCGCTGACTCATTGCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028108.3-1192s21c1
Sequence:CCGGGCAATACCTTGCTCTCTAATTCTCGAGAATTAGAGAGCAAGGTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028108
VALIDATED
NAA50 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 50, NatE catalytic subunit
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028108.3-503s21c1
Sequence:CCGGAGACTTTACATCATGACACTACTCGAGTAGTGTCATGATGTAAAGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028108.2-688s1c1
Sequence:CCGGCGAGACAAAGAAGAACTACTACTCGAGTAGTAGTTCTTCTTTGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028108.2-374s1c1
Sequence:CCGGCCAGTCAGCTATAATGATAAACTCGAGTTTATCATTATAGCTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028108.2-675s1c1
Sequence:CCGGGCTTTGAGATTATCGAGACAACTCGAGTTGTCTCGATAATCTCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028108.2-536s1c1
Sequence:CCGGCCTTACCGAAGACTAGGAATACTCGAGTATTCCTAGTCTTCGGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028108.2-2943s1c1
Sequence:CCGGGCTCCCTATTATAGCTTCTTTCTCGAGAAAGAAGCTATAATAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028108.3-636s21c1
Sequence:CCGGTCAGCAATGAGTCAGCGATTGCTCGAGCAATCGCTGACTCATTGCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028108.3-1192s21c1
Sequence:CCGGGCAATACCTTGCTCTCTAATTCTCGAGAATTAGAGAGCAAGGTATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028108
VALIDATED
NAA50 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 50, NatE catalytic subunit
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028108.3-503s21c1
Sequence:CCGGAGACTTTACATCATGACACTACTCGAGTAGTGTCATGATGTAAAGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028108.2-688s1c1
Sequence:CCGGCGAGACAAAGAAGAACTACTACTCGAGTAGTAGTTCTTCTTTGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028108.2-374s1c1
Sequence:CCGGCCAGTCAGCTATAATGATAAACTCGAGTTTATCATTATAGCTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028108.2-675s1c1
Sequence:CCGGGCTTTGAGATTATCGAGACAACTCGAGTTGTCTCGATAATCTCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028108.2-536s1c1
Sequence:CCGGCCTTACCGAAGACTAGGAATACTCGAGTATTCCTAGTCTTCGGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114586    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028108.2-2943s1c1
Sequence:CCGGGCTCCCTATTATAGCTTCTTTCTCGAGAAAGAAGCTATAATAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028108.3-636s21c1
Sequence:CCGGTCAGCAATGAGTCAGCGATTGCTCGAGCAATCGCTGACTCATTGCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439289    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028108.3-1192s21c1
Sequence:CCGGGCAATACCTTGCTCTCTAATTCTCGAGAATTAGAGAGCAAGGTATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025146
VALIDATED
NAA50 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 50, NatE catalytic subunit
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-501s21c1
Sequence:CCGGGAATCAGAAGAGACTTTACATCTCGAGATGTAAAGTCTCTTCTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-501s1c1
Sequence:CCGGGAATCAGAAGAGACTTTACATCTCGAGATGTAAAGTCTCTTCTGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-390s1c1
Sequence:CCGGCTACAATGACAAGTTCTACAACTCGAGTTGTAGAACTTGTCATTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-705s1c1
Sequence:CCGGGAAGAACTACTATAAGAGGATCTCGAGATCCTCTTATAGTAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025146.1-583s1c1
Sequence:CCGGCATGTCTTAAACATCTGTGAACTCGAGTTCACAGATGTTTAAGACATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025146.1-672s1c1
Sequence:CCGGCAGGAAGTTTGGCTTTGAGATCTCGAGATCTCAAAGCCAAACTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025146.1-736s1c1
Sequence:CCGGGATGCTCATGTGCTGCAGAAACTCGAGTTTCTGCAGCACATGAGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-642s1c1
Sequence:CCGGGATCAGCAATGAGTCGGCAATCTCGAGATTGCCGACTCATTGCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-390s21c1
Sequence:CCGGCTACAATGACAAGTTCTACAACTCGAGTTGTAGAACTTGTCATTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025146.1-834s21c1
Sequence:CCGGGCACTTGCTTGTCGCCAAATACTCGAGTATTTGGCGACAAGCAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-705s21c1
Sequence:CCGGGAAGAACTACTATAAGAGGATCTCGAGATCCTCTTATAGTAGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-329s21c1
Sequence:CCGGATGTGACACCACACAATATTACTCGAGTAATATTGTGTGGTGTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025146
VALIDATED
NAA50 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 50, NatE catalytic subunit
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-501s21c1
Sequence:CCGGGAATCAGAAGAGACTTTACATCTCGAGATGTAAAGTCTCTTCTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-501s1c1
Sequence:CCGGGAATCAGAAGAGACTTTACATCTCGAGATGTAAAGTCTCTTCTGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-390s1c1
Sequence:CCGGCTACAATGACAAGTTCTACAACTCGAGTTGTAGAACTTGTCATTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-705s1c1
Sequence:CCGGGAAGAACTACTATAAGAGGATCTCGAGATCCTCTTATAGTAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025146.1-583s1c1
Sequence:CCGGCATGTCTTAAACATCTGTGAACTCGAGTTCACAGATGTTTAAGACATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025146.1-672s1c1
Sequence:CCGGCAGGAAGTTTGGCTTTGAGATCTCGAGATCTCAAAGCCAAACTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025146.1-736s1c1
Sequence:CCGGGATGCTCATGTGCTGCAGAAACTCGAGTTTCTGCAGCACATGAGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-642s1c1
Sequence:CCGGGATCAGCAATGAGTCGGCAATCTCGAGATTGCCGACTCATTGCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-390s21c1
Sequence:CCGGCTACAATGACAAGTTCTACAACTCGAGTTGTAGAACTTGTCATTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025146.1-834s21c1
Sequence:CCGGGCACTTGCTTGTCGCCAAATACTCGAGTATTTGGCGACAAGCAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000276472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-705s21c1
Sequence:CCGGGAAGAACTACTATAAGAGGATCTCGAGATCCTCTTATAGTAGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-329s21c1
Sequence:CCGGATGTGACACCACACAATATTACTCGAGTAATATTGTGTGGTGTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025146
VALIDATED
NAA50 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 50, NatE catalytic subunit
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-501s21c1
Sequence:CCGGGAATCAGAAGAGACTTTACATCTCGAGATGTAAAGTCTCTTCTGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-501s1c1
Sequence:CCGGGAATCAGAAGAGACTTTACATCTCGAGATGTAAAGTCTCTTCTGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-390s1c1
Sequence:CCGGCTACAATGACAAGTTCTACAACTCGAGTTGTAGAACTTGTCATTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-705s1c1
Sequence:CCGGGAAGAACTACTATAAGAGGATCTCGAGATCCTCTTATAGTAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025146.1-583s1c1
Sequence:CCGGCATGTCTTAAACATCTGTGAACTCGAGTTCACAGATGTTTAAGACATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025146.1-672s1c1
Sequence:CCGGCAGGAAGTTTGGCTTTGAGATCTCGAGATCTCAAAGCCAAACTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025146.1-736s1c1
Sequence:CCGGGATGCTCATGTGCTGCAGAAACTCGAGTTTCTGCAGCACATGAGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_025146.1-642s1c1
Sequence:CCGGGATCAGCAATGAGTCGGCAATCTCGAGATTGCCGACTCATTGCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-390s21c1
Sequence:CCGGCTACAATGACAAGTTCTACAACTCGAGTTGTAGAACTTGTCATTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025146.1-834s21c1
Sequence:CCGGGCACTTGCTTGTCGCCAAATACTCGAGTATTTGGCGACAAGCAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000276472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-705s21c1
Sequence:CCGGGAAGAACTACTATAAGAGGATCTCGAGATCCTCTTATAGTAGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_025146.1-329s21c1
Sequence:CCGGATGTGACACCACACAATATTACTCGAGTAATATTGTGTGGTGTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)