EMAIL THIS PAGE TO A FRIEND

NAA60

N(alpha)-acetyltransferase 60, NatF catalytic subunit

87 Gene Product Result for
Synonyms: HAT4 NAT15
Gene ID:
Mouse(74763) N(alpha)-acetyltransferase 60, NatF catalytic subunit
Rat(363545) N(alpha)-acetyltransferase 60, NatF catalytic subunit
fruit fly(39142) N(alpha)-acetyltransferase 60
cow(514154) N(alpha)-acetyltransferase 60, NatF catalytic subunit
domestic cat(101097199) N(alpha)-acetyltransferase 60, NatF catalytic subunit
dog(609456) N(alpha)-acetyltransferase 60, NatF catalytic subunit
chicken(416659) N(alpha)-acetyltransferase 60, NatF catalytic subunit
sheep(101120793) N(alpha)-acetyltransferase 60, NatF catalytic subunit
domestic guinea pig(100715078) N(alpha)-acetyltransferase 60, NatF catalytic subunit
naked mole-rat(101705001) N(alpha)-acetyltransferase 60, NatF catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024845 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029090 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029090 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029090 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083600 Rosetta Predictions human pricing
NM_001083601 Rosetta Predictions human pricing
NM_024845 Rosetta Predictions human pricing
NM_001014226 Rosetta Predictions rat pricing
XM_001077604 Rosetta Predictions rat pricing
NM_029090 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083600 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317021 predicted 882
2 SASI_Hs02_00317022 predicted 709
3 SASI_Hs02_00317023 predicted 475
4 SASI_Hs02_00317024 predicted 596
5 SASI_Hs02_00317025 predicted 608
6 SASI_Hs02_00317026 predicted 629
7 SASI_Hs02_00317027 predicted 650
8 SASI_Hs02_00317028 predicted 483
9 SASI_Hs02_00317029 predicted 713
10 SASI_Hs02_00317030 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083601 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317031 predicted 936
2 SASI_Hs02_00317032 predicted 757
3 SASI_Hs02_00317033 predicted 525
4 SASI_Hs02_00317034 predicted 642
5 SASI_Hs02_00317035 predicted 662
6 SASI_Hs02_00317036 predicted 677
7 SASI_Hs02_00317037 predicted 706
8 SASI_Hs02_00317038 predicted 537
9 SASI_Hs02_00317039 predicted 768
10 SASI_Hs02_00317040 predicted 761
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043750 predicted 890
2 SASI_Hs02_00357420 predicted 714
3 SASI_Hs01_00043752 predicted 472
4 SASI_Hs01_00043754 predicted 591
5 SASI_Hs01_00043755 predicted 617
6 SASI_Hs01_00043757 predicted 627
7 SASI_Hs01_00043758 predicted 652
8 SASI_Hs01_00043759 predicted 486
9 SASI_Hs02_00357421 predicted 716
10 SASI_Hs02_00357422 predicted 709
11 SASI_Hs01_00043751 predicted 304
12 SASI_Hs01_00043753 predicted 231
13 SASI_Hs01_00043756 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081935 predicted 292
2 SASI_Rn02_00201763 predicted 259
3 SASI_Rn01_00081937 predicted 302
4 SASI_Rn01_00081938 predicted 442
5 SASI_Rn01_00081939 predicted 577
6 SASI_Rn01_00081940 predicted 437
7 SASI_Rn01_00081941 predicted 508
8 SASI_Rn01_00081942 predicted 626
9 SASI_Rn01_00081943 predicted 381
10 SASI_Rn01_00081944 predicted 534
11 SASI_Rn01_00081936 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357729 predicted 362
2 SASI_Rn02_00357730 predicted 325
3 SASI_Rn02_00357731 predicted 359
4 SASI_Rn02_00357732 predicted 507
5 SASI_Rn02_00357733 predicted 642
6 SASI_Rn02_00357734 predicted 506
7 SASI_Rn02_00357735 predicted 566
8 SASI_Rn02_00357736 predicted 692
9 SASI_Rn02_00357737 predicted 446
10 SASI_Rn02_00357738 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029090 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105353 predicted 381
2 SASI_Mm01_00105354 predicted 345
3 SASI_Mm01_00105355 predicted 383
4 SASI_Mm01_00105356 predicted 325
5 SASI_Mm01_00105357 predicted 309
6 SASI_Mm01_00105358 predicted 603
7 SASI_Mm01_00105359 predicted 652
8 SASI_Mm01_00105360 predicted 713
9 SASI_Mm01_00105361 predicted 667
10 SASI_Mm01_00105362 predicted 961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024845
VALIDATED
NAA60 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 60, NatF catalytic subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024845.2-1371s21c1
Sequence:CCGGATGGACACACTTGACCGTAAACTCGAGTTTACGGTCAAGTGTGTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024845.2-618s21c1
Sequence:CCGGCCACCAACAACACAGCAATAACTCGAGTTATTGCTGTGTTGTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024845.2-378s21c1
Sequence:CCGGGTGCCATTGTGGGAATGATAGCTCGAGCTATCATTCCCACAATGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-620s1c1
Sequence:CCGGCCTCAAAGATGGCTTCACCTACTCGAGTAGGTGAAGCCATCTTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-318s1c1
Sequence:CCGGGAAATTAAGAACAGGACCAAACTCGAGTTTGGTCCTGTTCTTAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024845.1-226s1c1
Sequence:CCGGCAGACTCATGGTATCGTGATACTCGAGTATCACGATACCATGAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-170s1c1
Sequence:CCGGCGATGACATAGACACTGTGAACTCGAGTTCACAGTGTCTATGTCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-416s1c1
Sequence:CCGGCGTCGTGAAAGAGTTCAGGAACTCGAGTTCCTGAACTCTTTCACGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-225s1c1
Sequence:CCGGCCAGACTCATGGTATCGTGATCTCGAGATCACGATACCATGAGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024845
VALIDATED
NAA60 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 60, NatF catalytic subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024845.2-1371s21c1
Sequence:CCGGATGGACACACTTGACCGTAAACTCGAGTTTACGGTCAAGTGTGTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024845.2-618s21c1
Sequence:CCGGCCACCAACAACACAGCAATAACTCGAGTTATTGCTGTGTTGTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024845.2-378s21c1
Sequence:CCGGGTGCCATTGTGGGAATGATAGCTCGAGCTATCATTCCCACAATGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-620s1c1
Sequence:CCGGCCTCAAAGATGGCTTCACCTACTCGAGTAGGTGAAGCCATCTTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-318s1c1
Sequence:CCGGGAAATTAAGAACAGGACCAAACTCGAGTTTGGTCCTGTTCTTAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024845.1-226s1c1
Sequence:CCGGCAGACTCATGGTATCGTGATACTCGAGTATCACGATACCATGAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-170s1c1
Sequence:CCGGCGATGACATAGACACTGTGAACTCGAGTTCACAGTGTCTATGTCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-416s1c1
Sequence:CCGGCGTCGTGAAAGAGTTCAGGAACTCGAGTTCCTGAACTCTTTCACGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-225s1c1
Sequence:CCGGCCAGACTCATGGTATCGTGATCTCGAGATCACGATACCATGAGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024845
VALIDATED
NAA60 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 60, NatF catalytic subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024845.2-1371s21c1
Sequence:CCGGATGGACACACTTGACCGTAAACTCGAGTTTACGGTCAAGTGTGTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024845.2-618s21c1
Sequence:CCGGCCACCAACAACACAGCAATAACTCGAGTTATTGCTGTGTTGTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024845.2-378s21c1
Sequence:CCGGGTGCCATTGTGGGAATGATAGCTCGAGCTATCATTCCCACAATGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-620s1c1
Sequence:CCGGCCTCAAAGATGGCTTCACCTACTCGAGTAGGTGAAGCCATCTTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158889    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-318s1c1
Sequence:CCGGGAAATTAAGAACAGGACCAAACTCGAGTTTGGTCCTGTTCTTAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024845.1-226s1c1
Sequence:CCGGCAGACTCATGGTATCGTGATACTCGAGTATCACGATACCATGAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162627    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-170s1c1
Sequence:CCGGCGATGACATAGACACTGTGAACTCGAGTTCACAGTGTCTATGTCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-416s1c1
Sequence:CCGGCGTCGTGAAAGAGTTCAGGAACTCGAGTTCCTGAACTCTTTCACGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024845.1-225s1c1
Sequence:CCGGCCAGACTCATGGTATCGTGATCTCGAGATCACGATACCATGAGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029090
VALIDATED
NAA60 MISSION shRNA Bacterial Glycerol Stock
N(alpha)-acetyltransferase 60, NatF catalytic subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029090.3-665s21c1
Sequence:CCGGGCATCACTATCTGCCCTACTACTCGAGTAGTAGGGCAGATAGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029090.3-311s21c1
Sequence:CCGGAGACTCATGGTATCGTGATATCTCGAGATATCACGATACCATGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029090.3-1375s21c1
Sequence:CCGGGCGTTCTTACTCCTCCATGAACTCGAGTTCATGGAGGAGTAAGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029090.3-501s21c1
Sequence:CCGGGTGGTGAAAGAGTTCAGGAAACTCGAGTTTCCTGAACTCTTTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029090.3-386s21c1
Sequence:CCGGGGGAATGATAGTAGCTGAAATCTCGAGATTTCAGCTACTATCATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-1311s1c1
Sequence:CCGGGCGTTCTTACTCCTCCATGAACTCGAGTTCATGGAGGAGTAAGAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-437s1c1
Sequence:CCGGGTGGTGAAAGAGTTCAGGAAACTCGAGTTTCCTGAACTCTTTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-223s1c1
Sequence:CCGGCGACTGGTTTCCCATTGAGTACTCGAGTACTCAATGGGAAACCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-601s1c1
Sequence:CCGGGCATCACTATCTGCCCTACTACTCGAGTAGTAGGGCAGATAGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-247s1c1
Sequence:CCGGAGACTCATGGTATCGTGATATCTCGAGATATCACGATACCATGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029090
VALIDATED
NAA60 MISSION shRNA shRNA Plasmid DNA
N(alpha)-acetyltransferase 60, NatF catalytic subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029090.3-665s21c1
Sequence:CCGGGCATCACTATCTGCCCTACTACTCGAGTAGTAGGGCAGATAGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029090.3-311s21c1
Sequence:CCGGAGACTCATGGTATCGTGATATCTCGAGATATCACGATACCATGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029090.3-1375s21c1
Sequence:CCGGGCGTTCTTACTCCTCCATGAACTCGAGTTCATGGAGGAGTAAGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029090.3-501s21c1
Sequence:CCGGGTGGTGAAAGAGTTCAGGAAACTCGAGTTTCCTGAACTCTTTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029090.3-386s21c1
Sequence:CCGGGGGAATGATAGTAGCTGAAATCTCGAGATTTCAGCTACTATCATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-1311s1c1
Sequence:CCGGGCGTTCTTACTCCTCCATGAACTCGAGTTCATGGAGGAGTAAGAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-437s1c1
Sequence:CCGGGTGGTGAAAGAGTTCAGGAAACTCGAGTTTCCTGAACTCTTTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-223s1c1
Sequence:CCGGCGACTGGTTTCCCATTGAGTACTCGAGTACTCAATGGGAAACCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-601s1c1
Sequence:CCGGGCATCACTATCTGCCCTACTACTCGAGTAGTAGGGCAGATAGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000114645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-247s1c1
Sequence:CCGGAGACTCATGGTATCGTGATATCTCGAGATATCACGATACCATGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029090
VALIDATED
NAA60 MISSION shRNA Lentiviral Transduction Particles
N(alpha)-acetyltransferase 60, NatF catalytic subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029090.3-665s21c1
Sequence:CCGGGCATCACTATCTGCCCTACTACTCGAGTAGTAGGGCAGATAGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029090.3-311s21c1
Sequence:CCGGAGACTCATGGTATCGTGATATCTCGAGATATCACGATACCATGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029090.3-1375s21c1
Sequence:CCGGGCGTTCTTACTCCTCCATGAACTCGAGTTCATGGAGGAGTAAGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029090.3-501s21c1
Sequence:CCGGGTGGTGAAAGAGTTCAGGAAACTCGAGTTTCCTGAACTCTTTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_029090.3-386s21c1
Sequence:CCGGGGGAATGATAGTAGCTGAAATCTCGAGATTTCAGCTACTATCATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-1311s1c1
Sequence:CCGGGCGTTCTTACTCCTCCATGAACTCGAGTTCATGGAGGAGTAAGAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-437s1c1
Sequence:CCGGGTGGTGAAAGAGTTCAGGAAACTCGAGTTTCCTGAACTCTTTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-223s1c1
Sequence:CCGGCGACTGGTTTCCCATTGAGTACTCGAGTACTCAATGGGAAACCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-601s1c1
Sequence:CCGGGCATCACTATCTGCCCTACTACTCGAGTAGTAGGGCAGATAGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000114645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_029090.2-247s1c1
Sequence:CCGGAGACTCATGGTATCGTGATATCTCGAGATATCACGATACCATGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)