EMAIL THIS PAGE TO A FRIEND

NAAA

N-acylethanolamine acid amidase

58 Gene Product Result for
Synonyms: ASAHL PLT
UniProtKB ID: Q02083, Q5KTF2, Q96EY2, Q9BRA8
Gene ID:
Human(27163) Summary: This gene encodes an N-acylethanolamine-hydrolyzing enzyme which is highly similar to acid ceramidase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(67111) N-acylethanolamine acid amidase
Rat(497009) N-acylethanolamine acid amidase
naked mole-rat(101720767) N-acylethanolamine acid amidase
domestic guinea pig(100714059) N-acylethanolamine acid amidase
sheep(101105252) N-acylethanolamine acid amidase
chicken(422641) N-acylethanolamine acid amidase
dog(100685826) N-acylethanolamine acid amidase
domestic cat(101091867) N-acylethanolamine acid amidase
cow(515375) N-acylethanolamine acid amidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108648 Anti-ASAHL affinity isolated antibody pig, rabbit, mouse, horse, rabbit, guinea pig, rat, bovine
immunohistochemistry, western blot pricing
SAB2100160 Anti-ASAHL antibody produced in rabbit affinity isolated antibody human, rat, mouse, bovine, rabbit, guinea pig, horse
western blot pricing
SAB1410535 Anti-ASAHL antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
WH0027163M1 Monoclonal Anti-ASAHL antibody produced in mouse clone 5E3, purified immunoglobulin, buffered aqueous solution mouse
ELISA, immunofluorescence, western blot pricing
SAB1405035 Monoclonal Anti-NAAA antibody produced in mouse clone 3F4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1275 Human ASAHL ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014435 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042402 Rosetta Predictions human pricing
NM_014435 Rosetta Predictions human pricing
NM_001010967 Rosetta Predictions rat pricing
NM_025972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309538 predicted 364
2 SASI_Hs02_00309539 predicted 758
3 SASI_Hs02_00309540 predicted 214
4 SASI_Hs02_00309541 predicted 618
5 SASI_Hs02_00309542 predicted 442
6 SASI_Hs02_00309543 predicted 685
7 SASI_Hs02_00309544 predicted 277
8 SASI_Hs02_00309545 predicted 588
9 SASI_Hs02_00309546 predicted 410
10 SASI_Hs02_00309547 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153325 predicted 360
2 SASI_Hs02_00345642 predicted 755
3 SASI_Hs01_00153327 predicted 219
4 SASI_Hs01_00153328 predicted 611
5 SASI_Hs01_00153329 predicted 436
6 SASI_Hs02_00345643 predicted 687
7 SASI_Hs01_00153330 predicted 277
8 SASI_Hs01_00153331 predicted 581
9 SASI_Hs01_00153332 predicted 410
10 SASI_Hs01_00153333 predicted 524
11 SASI_Hs01_00153326 predicted 510
12 SASI_Hs01_00153334 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010967 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095499 predicted 382
2 SASI_Rn01_00095500 predicted 751
3 SASI_Rn01_00095501 predicted 803
4 SASI_Rn01_00095502 predicted 331
5 SASI_Rn01_00095503 predicted 1027
6 SASI_Rn01_00095504 predicted 527
7 SASI_Rn01_00095505 predicted 1133
8 SASI_Rn01_00095506 predicted 881
9 SASI_Rn01_00095507 predicted 1024
10 SASI_Rn01_00095508 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131629 predicted 781
2 SASI_Mm01_00131630 predicted 558
3 SASI_Mm01_00131631 predicted 1063
4 SASI_Mm01_00131632 predicted 918
5 SASI_Mm01_00131633 predicted 1058
6 SASI_Mm01_00131634 predicted 1040
7 SASI_Mm01_00131636 predicted 437
8 SASI_Mm01_00131637 predicted 1155
9 SASI_Mm01_00131638 predicted 969
10 SASI_Mm02_00329392 predicted 1164
11 SASI_Mm01_00131635 predicted 963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014435
VALIDATED
NAAA MISSION shRNA Bacterial Glycerol Stock
N-acylethanolamine acid amidase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-607s1c1
Sequence:CCGGGCCCACACAAGTTTACAGTTTCTCGAGAAACTGTAAACTTGTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-420s1c1
Sequence:CCGGTCCGTGTTCTGCACCAGTATTCTCGAGAATACTGGTGCAGAACACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-353s1c1
Sequence:CCGGCGGCATGTGTGACTTCATGAACTCGAGTTCATGAAGTCACACATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-209s1c1
Sequence:CCGGGCGGCACTACGACTTGGACTTCTCGAGAAGTCCAAGTCGTAGTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014435.1-471s1c1
Sequence:CCGGCATGGTCGGAATTTGGATTATCTCGAGATAATCCAAATTCCGACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-482s21c1
Sequence:CCGGCATGGTCGGAATTTGGATTATCTCGAGATAATCCAAATTCCGACCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-220s21c1
Sequence:CCGGGCGGCACTACGACTTGGACTTCTCGAGAAGTCCAAGTCGTAGTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-431s21c1
Sequence:CCGGTCCGTGTTCTGCACCAGTATTCTCGAGAATACTGGTGCAGAACACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-364s21c1
Sequence:CCGGCGGCATGTGTGACTTCATGAACTCGAGTTCATGAAGTCACACATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-618s21c1
Sequence:CCGGGCCCACACAAGTTTACAGTTTCTCGAGAAACTGTAAACTTGTGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014435
VALIDATED
NAAA MISSION shRNA shRNA Plasmid DNA
N-acylethanolamine acid amidase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-607s1c1
Sequence:CCGGGCCCACACAAGTTTACAGTTTCTCGAGAAACTGTAAACTTGTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-420s1c1
Sequence:CCGGTCCGTGTTCTGCACCAGTATTCTCGAGAATACTGGTGCAGAACACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-353s1c1
Sequence:CCGGCGGCATGTGTGACTTCATGAACTCGAGTTCATGAAGTCACACATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-209s1c1
Sequence:CCGGGCGGCACTACGACTTGGACTTCTCGAGAAGTCCAAGTCGTAGTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014435.1-471s1c1
Sequence:CCGGCATGGTCGGAATTTGGATTATCTCGAGATAATCCAAATTCCGACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-482s21c1
Sequence:CCGGCATGGTCGGAATTTGGATTATCTCGAGATAATCCAAATTCCGACCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-220s21c1
Sequence:CCGGGCGGCACTACGACTTGGACTTCTCGAGAAGTCCAAGTCGTAGTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-431s21c1
Sequence:CCGGTCCGTGTTCTGCACCAGTATTCTCGAGAATACTGGTGCAGAACACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-364s21c1
Sequence:CCGGCGGCATGTGTGACTTCATGAACTCGAGTTCATGAAGTCACACATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-618s21c1
Sequence:CCGGGCCCACACAAGTTTACAGTTTCTCGAGAAACTGTAAACTTGTGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014435
VALIDATED
NAAA MISSION shRNA Lentiviral Transduction Particles
N-acylethanolamine acid amidase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-607s1c1
Sequence:CCGGGCCCACACAAGTTTACAGTTTCTCGAGAAACTGTAAACTTGTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-420s1c1
Sequence:CCGGTCCGTGTTCTGCACCAGTATTCTCGAGAATACTGGTGCAGAACACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-353s1c1
Sequence:CCGGCGGCATGTGTGACTTCATGAACTCGAGTTCATGAAGTCACACATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014435.1-209s1c1
Sequence:CCGGGCGGCACTACGACTTGGACTTCTCGAGAAGTCCAAGTCGTAGTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_014435.1-471s1c1
Sequence:CCGGCATGGTCGGAATTTGGATTATCTCGAGATAATCCAAATTCCGACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-482s21c1
Sequence:CCGGCATGGTCGGAATTTGGATTATCTCGAGATAATCCAAATTCCGACCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-220s21c1
Sequence:CCGGGCGGCACTACGACTTGGACTTCTCGAGAAGTCCAAGTCGTAGTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-431s21c1
Sequence:CCGGTCCGTGTTCTGCACCAGTATTCTCGAGAATACTGGTGCAGAACACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-364s21c1
Sequence:CCGGCGGCATGTGTGACTTCATGAACTCGAGTTCATGAAGTCACACATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014435.3-618s21c1
Sequence:CCGGGCCCACACAAGTTTACAGTTTCTCGAGAAACTGTAAACTTGTGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025972
NAAA MISSION shRNA Bacterial Glycerol Stock
N-acylethanolamine acid amidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025972.1-1508s1c1
Sequence:CCGGCCGATAGATAGATAGATGATACTCGAGTATCATCTATCTATCTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-796s1c1
Sequence:CCGGGCTGACGTTTATTACATTGTTCTCGAGAACAATGTAATAAACGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-614s1c1
Sequence:CCGGGCCAAAGTCCACACAAGTTTACTCGAGTAAACTTGTGTGGACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-912s1c1
Sequence:CCGGCCGAGTTGAGACAAATTATGACTCGAGTCATAATTTGTCTCAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-916s1c1
Sequence:CCGGGTTGAGACAAATTATGACCATCTCGAGATGGTCATAATTTGTCTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025972
NAAA MISSION shRNA shRNA Plasmid DNA
N-acylethanolamine acid amidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025972.1-1508s1c1
Sequence:CCGGCCGATAGATAGATAGATGATACTCGAGTATCATCTATCTATCTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-796s1c1
Sequence:CCGGGCTGACGTTTATTACATTGTTCTCGAGAACAATGTAATAAACGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-614s1c1
Sequence:CCGGGCCAAAGTCCACACAAGTTTACTCGAGTAAACTTGTGTGGACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-912s1c1
Sequence:CCGGCCGAGTTGAGACAAATTATGACTCGAGTCATAATTTGTCTCAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-916s1c1
Sequence:CCGGGTTGAGACAAATTATGACCATCTCGAGATGGTCATAATTTGTCTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025972
NAAA MISSION shRNA Lentiviral Transduction Particles
N-acylethanolamine acid amidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025972.1-1508s1c1
Sequence:CCGGCCGATAGATAGATAGATGATACTCGAGTATCATCTATCTATCTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-796s1c1
Sequence:CCGGGCTGACGTTTATTACATTGTTCTCGAGAACAATGTAATAAACGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-614s1c1
Sequence:CCGGGCCAAAGTCCACACAAGTTTACTCGAGTAAACTTGTGTGGACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-912s1c1
Sequence:CCGGCCGAGTTGAGACAAATTATGACTCGAGTCATAATTTGTCTCAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025972.1-916s1c1
Sequence:CCGGGTTGAGACAAATTATGACCATCTCGAGATGGTCATAATTTGTCTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)