EMAIL THIS PAGE TO A FRIEND

NAALADL2

N-acetylated alpha-linked acidic dipeptidase-like 2

147 Gene Product Result for
UniProtKB ID: Q58DX5, Q658X9, Q6H9J8, Q6H9J9, Q6PG38
Gene ID:
Mouse(635702) N-acetylated alpha-linked acidic dipeptidase-like 2
Rat(499583) N-acetylated alpha-linked acidic dipeptidase-like 2
sheep(101111764) N-acetylated alpha-linked acidic dipeptidase-like 2
domestic guinea pig(100719214) N-acetylated alpha-linked acidic dipeptidase-like 2
naked mole-rat(101707025) N-acetylated alpha-linked acidic dipeptidase-like 2
Domestic Rabbit(100342215) N-acetylated alpha-linked acidic dipeptidase-like 2
chicken(429156) N-acetylated alpha-linked acidic dipeptidase-like 2
cow(781025) N-acetylated alpha-linked acidic dipeptidase-like 2
cow(100337356) N-acetylated alpha-linked acidic dipeptidase-like 2
Horse(100064889) N-acetylated alpha-linked acidic dipeptidase-like 2
domestic cat(101098650) N-acetylated alpha-linked acidic dipeptidase-like 2
dog(488174) N-acetylated alpha-linked acidic dipeptidase-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207015 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041271 MISSION® esiRNA esiRNA human NAALADL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207015 Rosetta Predictions human pricing
XM_001062720 Rosetta Predictions rat pricing
XM_574908 Rosetta Predictions rat pricing
XM_910834 Rosetta Predictions mouse pricing
XM_975226 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219432 predicted 962
2 SASI_Hs01_00219433 predicted 891
3 SASI_Hs01_00219434 predicted 1458
4 SASI_Hs01_00219435 predicted 391
5 SASI_Hs01_00219436 predicted 1959
6 SASI_Hs02_00373711 predicted 1334
7 SASI_Hs02_00373712 predicted 1492
8 SASI_Hs02_00373713 predicted 1621
9 SASI_Hs01_00219439 predicted 316
10 SASI_Hs01_00219441 predicted 382
11 SASI_Hs01_00219437 predicted 368
12 SASI_Hs01_00219438 predicted 245
13 SASI_Hs01_00219440 predicted 1941
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062720 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304382 predicted 680
2 SASI_Rn02_00304383 predicted 746
3 SASI_Rn02_00304384 predicted 591
4 SASI_Rn02_00304385 predicted 241
5 SASI_Rn02_00304386 predicted 1327
6 SASI_Rn02_00304387 predicted 470
7 SASI_Rn02_00304388 predicted 654
8 SASI_Rn02_00304389 predicted 2005
9 SASI_Rn02_00304390 predicted 893
10 SASI_Rn02_00304391 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402755 predicted 678
2 SASI_Rn02_00402756 predicted 750
3 SASI_Rn02_00402757 predicted 587
4 SASI_Rn02_00402758 predicted 238
5 SASI_Rn02_00402759 predicted 1334
6 SASI_Rn02_00402760 predicted 469
7 SASI_Rn02_00402761 predicted 660
8 SASI_Rn02_00402762 predicted 2005
9 SASI_Rn02_00402763 predicted 887
10 SASI_Rn02_00402764 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_910834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00435953 predicted 473
2 SASI_Mm02_00435954 predicted 584
3 SASI_Mm02_00435955 predicted 639
4 SASI_Mm02_00435956 predicted 1327
5 SASI_Mm02_00435957 predicted 660
6 SASI_Mm02_00435958 predicted 461
7 SASI_Mm02_00435959 predicted 1130
8 SASI_Mm02_00435960 predicted 670
9 SASI_Mm02_00435961 predicted 817
10 SASI_Mm02_00435962 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_975226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00445580 predicted 1466
2 SASI_Mm02_00445581 predicted 1453
3 SASI_Mm02_00445582 predicted 1295
4 SASI_Mm02_00445583 predicted 1329
5 SASI_Mm02_00445584 predicted 1129
6 SASI_Mm02_00445585 predicted 1360
7 SASI_Mm02_00445586 predicted 1990
8 SASI_Mm02_00445587 predicted 1614
9 SASI_Mm02_00445588 predicted 1995
10 SASI_Mm02_00445589 predicted 1743
11 SASI_Mm01_00286063 predicted 481
12 SASI_Mm01_00286064 predicted 598
13 SASI_Mm01_00286065 predicted 442
14 SASI_Mm01_00286066 predicted 436
15 SASI_Mm01_00286067 predicted 641
16 SASI_Mm01_00286068 predicted 663
17 SASI_Mm01_00286069 predicted 466
18 SASI_Mm01_00286070 predicted 678
19 SASI_Mm01_00286071 predicted 634
20 SASI_Mm01_00286072 predicted 814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207015
NAALADL2 MISSION shRNA Bacterial Glycerol Stock
N-acetylated alpha-linked acidic dipeptidase-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-328s1c1
Sequence:CCGGGACCTCAATCTTGATTCCATTCTCGAGAATGGAATCAAGATTGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207015.1-4238s1c1
Sequence:CCGGGCCATGTTGAAGAGTGTGTATCTCGAGATACACACTCTTCAACATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-2028s1c1
Sequence:CCGGGCCCTTTAATGCACTTGATATCTCGAGATATCAAGTGCATTAAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-1341s1c1
Sequence:CCGGGCAAGTTCAGACAGTCACAAACTCGAGTTTGTGACTGTCTGAACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-2086s1c1
Sequence:CCGGCCCAACACTCATCAACTGTTACTCGAGTAACAGTTGATGAGTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207015
NAALADL2 MISSION shRNA shRNA Plasmid DNA
N-acetylated alpha-linked acidic dipeptidase-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-328s1c1
Sequence:CCGGGACCTCAATCTTGATTCCATTCTCGAGAATGGAATCAAGATTGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207015.1-4238s1c1
Sequence:CCGGGCCATGTTGAAGAGTGTGTATCTCGAGATACACACTCTTCAACATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-2028s1c1
Sequence:CCGGGCCCTTTAATGCACTTGATATCTCGAGATATCAAGTGCATTAAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-1341s1c1
Sequence:CCGGGCAAGTTCAGACAGTCACAAACTCGAGTTTGTGACTGTCTGAACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-2086s1c1
Sequence:CCGGCCCAACACTCATCAACTGTTACTCGAGTAACAGTTGATGAGTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207015
NAALADL2 MISSION shRNA Lentiviral Transduction Particles
N-acetylated alpha-linked acidic dipeptidase-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-328s1c1
Sequence:CCGGGACCTCAATCTTGATTCCATTCTCGAGAATGGAATCAAGATTGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207015.1-4238s1c1
Sequence:CCGGGCCATGTTGAAGAGTGTGTATCTCGAGATACACACTCTTCAACATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-2028s1c1
Sequence:CCGGGCCCTTTAATGCACTTGATATCTCGAGATATCAAGTGCATTAAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-1341s1c1
Sequence:CCGGGCAAGTTCAGACAGTCACAAACTCGAGTTTGTGACTGTCTGAACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207015.1-2086s1c1
Sequence:CCGGCCCAACACTCATCAACTGTTACTCGAGTAACAGTTGATGAGTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)