EMAIL THIS PAGE TO A FRIEND

NAB1

NGFI-A binding protein 1 (EGR1 binding protein 1)

194 Gene Product Result for
UniProtKB ID: Q13506, O75383, O75384, Q6GTU1, Q9UEV1
Gene ID:
Mouse(17936) Ngfi-A binding protein 1
Rat(64824) Ngfi-A binding protein 1
chicken(374126) NGFI-A binding protein 1 (EGR1 binding protein 1)
Horse(100054645) NGFI-A binding protein 1 (EGR1 binding protein 1)
cow(516781) NGFI-A binding protein 1 (EGR1 binding protein 1)
domestic cat(101083872) NGFI-A binding protein 1 (EGR1 binding protein 1)
dog(488447) NGFI-A binding protein 1 (EGR1 binding protein 1)
Domestic Rabbit(100343208) NGFI-A binding protein 1 (EGR1 binding protein 1)
naked mole-rat(101720292) NGFI-A binding protein 1 (EGR1 binding protein 1)
domestic guinea pig(100733462) NGFI-A binding protein 1 (EGR1 binding protein 1)
sheep(101110389) NGFI-A binding protein 1 (EGR1 binding protein 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV32032 Anti-NAB1 (AB1) antibody produced in rabbit affinity isolated antibody rat, guinea pig, zebrafish, canine, human, horse, bovine, mouse
immunohistochemistry, western blot pricing
AV38714 Anti-NAB1 (AB2) antibody produced in rabbit affinity isolated antibody rat, human, horse, canine, mouse, zebrafish, guinea pig, rabbit, bovine,
western blot pricing
HPA002738 Anti-NAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005966 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005966 Rosetta Predictions human pricing
NM_022856 Rosetta Predictions rat pricing
NM_008667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031578 predicted 885
2 SASI_Hs02_00340640 predicted 2061
3 SASI_Hs01_00031579 predicted 1634
4 SASI_Hs01_00031580 predicted 1411
5 SASI_Hs01_00031581 predicted 2130
6 SASI_Hs02_00340641 predicted 2071
7 SASI_Hs01_00031582 predicted 1330
8 SASI_Hs01_00031583 predicted 1273
9 SASI_Hs01_00031585 predicted 1436
10 SASI_Hs01_00031586 predicted 1378
11 SASI_Hs01_00031584 predicted 1325
12 SASI_Hs01_00031587 predicted 1563
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022856 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091737 predicted 2102
2 SASI_Rn01_00091738 predicted 1354
3 SASI_Rn01_00091739 predicted 2156
4 SASI_Rn01_00091740 predicted 1569
5 SASI_Rn01_00091741 predicted 808
6 SASI_Rn01_00091742 predicted 382
7 SASI_Rn01_00091743 predicted 1620
8 SASI_Rn01_00091744 predicted 1767
9 SASI_Rn01_00091745 predicted 665
10 SASI_Rn01_00091746 predicted 1390
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314423 predicted 901
2 SASI_Mm01_00123012 predicted 933
3 SASI_Mm01_00123013 predicted 1669
4 SASI_Mm01_00123014 predicted 387
5 SASI_Mm01_00123016 predicted 1196
6 SASI_Mm01_00123017 predicted 501
7 SASI_Mm01_00123018 predicted 1049
8 SASI_Mm01_00123019 predicted 1094
9 SASI_Mm01_00123020 predicted 984
10 SASI_Mm01_00123021 predicted 1625
11 SASI_Mm01_00123015 predicted 1513
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008667
VALIDATED
NAB1 MISSION shRNA Bacterial Glycerol Stock
NGFI-A binding protein 1 (EGR1 binding protein 1)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008667.2-1696s1c1
Sequence:CCGGCCATCATAGATTAAGCCTTAACTCGAGTTAAGGCTTAATCTATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008667.2-250s1c1
Sequence:CCGGGCTTTCTTACTTTGATGCCTTCTCGAGAAGGCATCAAAGTAAGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008667.2-1140s1c1
Sequence:CCGGGTGGTGAAAGAGATGAATTATCTCGAGATAATTCATCTCTTTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008667.2-513s1c1
Sequence:CCGGGCAATAGTTATGAAAGGAGTACTCGAGTACTCCTTTCATAACTATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008667.2-1584s1c1
Sequence:CCGGACTCTGCATTCACCTTGGAAACTCGAGTTTCCAAGGTGAATGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-1140s21c1
Sequence:CCGGGTGGTGAAAGAGATGAATTATCTCGAGATAATTCATCTCTTTCACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-2047s21c1
Sequence:CCGGATGTTACTCGTCAGCAATTAGCTCGAGCTAATTGCTGACGAGTAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.3-532s21c1
Sequence:CCGGAGTAGCATACCCATCTATAAACTCGAGTTTATAGATGGGTATGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008667.3-1004s21c1
Sequence:CCGGGAAAGTACAGCGCCATCTATGCTCGAGCATAGATGGCGCTGTACTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-1093s21c1
Sequence:CCGGTCGAGAAGTTACCTACAAGTACTCGAGTACTTGTAGGTAACTTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-894s21c1
Sequence:CCGGGTGACGAAGACCCACACAAAGCTCGAGCTTTGTGTGGGTCTTCGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-396s21c1
Sequence:CCGGTGAGAGACTGGGTTACAAATCCTCGAGGATTTGTAACCCAGTCTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.3-1629s21c1
Sequence:CCGGAGAGAGCCTTGGGATTCTAAACTCGAGTTTAGAATCCCAAGGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.3-1974s21c1
Sequence:CCGGATTGTAGGCATTCACTATTTACTCGAGTAAATAGTGAATGCCTACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008667
VALIDATED
NAB1 MISSION shRNA shRNA Plasmid DNA
NGFI-A binding protein 1 (EGR1 binding protein 1)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008667.2-1696s1c1
Sequence:CCGGCCATCATAGATTAAGCCTTAACTCGAGTTAAGGCTTAATCTATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008667.2-250s1c1
Sequence:CCGGGCTTTCTTACTTTGATGCCTTCTCGAGAAGGCATCAAAGTAAGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008667.2-1140s1c1
Sequence:CCGGGTGGTGAAAGAGATGAATTATCTCGAGATAATTCATCTCTTTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008667.2-513s1c1
Sequence:CCGGGCAATAGTTATGAAAGGAGTACTCGAGTACTCCTTTCATAACTATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008667.2-1584s1c1
Sequence:CCGGACTCTGCATTCACCTTGGAAACTCGAGTTTCCAAGGTGAATGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000351197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-1140s21c1
Sequence:CCGGGTGGTGAAAGAGATGAATTATCTCGAGATAATTCATCTCTTTCACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-2047s21c1
Sequence:CCGGATGTTACTCGTCAGCAATTAGCTCGAGCTAATTGCTGACGAGTAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.3-532s21c1
Sequence:CCGGAGTAGCATACCCATCTATAAACTCGAGTTTATAGATGGGTATGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008667.3-1004s21c1
Sequence:CCGGGAAAGTACAGCGCCATCTATGCTCGAGCATAGATGGCGCTGTACTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-1093s21c1
Sequence:CCGGTCGAGAAGTTACCTACAAGTACTCGAGTACTTGTAGGTAACTTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-894s21c1
Sequence:CCGGGTGACGAAGACCCACACAAAGCTCGAGCTTTGTGTGGGTCTTCGTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-396s21c1
Sequence:CCGGTGAGAGACTGGGTTACAAATCCTCGAGGATTTGTAACCCAGTCTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.3-1629s21c1
Sequence:CCGGAGAGAGCCTTGGGATTCTAAACTCGAGTTTAGAATCCCAAGGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.3-1974s21c1
Sequence:CCGGATTGTAGGCATTCACTATTTACTCGAGTAAATAGTGAATGCCTACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008667
VALIDATED
NAB1 MISSION shRNA Lentiviral Transduction Particles
NGFI-A binding protein 1 (EGR1 binding protein 1)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096134    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008667.2-1696s1c1
Sequence:CCGGCCATCATAGATTAAGCCTTAACTCGAGTTAAGGCTTAATCTATGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008667.2-250s1c1
Sequence:CCGGGCTTTCTTACTTTGATGCCTTCTCGAGAAGGCATCAAAGTAAGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008667.2-1140s1c1
Sequence:CCGGGTGGTGAAAGAGATGAATTATCTCGAGATAATTCATCTCTTTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008667.2-513s1c1
Sequence:CCGGGCAATAGTTATGAAAGGAGTACTCGAGTACTCCTTTCATAACTATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008667.2-1584s1c1
Sequence:CCGGACTCTGCATTCACCTTGGAAACTCGAGTTTCCAAGGTGAATGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000351197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-1140s21c1
Sequence:CCGGGTGGTGAAAGAGATGAATTATCTCGAGATAATTCATCTCTTTCACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-2047s21c1
Sequence:CCGGATGTTACTCGTCAGCAATTAGCTCGAGCTAATTGCTGACGAGTAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.3-532s21c1
Sequence:CCGGAGTAGCATACCCATCTATAAACTCGAGTTTATAGATGGGTATGCTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008667.3-1004s21c1
Sequence:CCGGGAAAGTACAGCGCCATCTATGCTCGAGCATAGATGGCGCTGTACTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-1093s21c1
Sequence:CCGGTCGAGAAGTTACCTACAAGTACTCGAGTACTTGTAGGTAACTTCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-894s21c1
Sequence:CCGGGTGACGAAGACCCACACAAAGCTCGAGCTTTGTGTGGGTCTTCGTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.2-396s21c1
Sequence:CCGGTGAGAGACTGGGTTACAAATCCTCGAGGATTTGTAACCCAGTCTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.3-1629s21c1
Sequence:CCGGAGAGAGCCTTGGGATTCTAAACTCGAGTTTAGAATCCCAAGGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008667.3-1974s21c1
Sequence:CCGGATTGTAGGCATTCACTATTTACTCGAGTAAATAGTGAATGCCTACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005966
VALIDATED
NAB1 MISSION shRNA Bacterial Glycerol Stock
NGFI-A binding protein 1 (EGR1 binding protein 1)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-746s1c1
Sequence:CCGGCCACACAAAGAGGAGGAAATTCTCGAGAATTTCCTCCTCTTTGTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-351s1c1
Sequence:CCGGGCAGTAGTTATGAAAGGAGTACTCGAGTACTCCTTTCATAACTACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-920s1c1
Sequence:CCGGGCTCGACAGATTTCTCGAGAACTCGAGTTCTCGAGAAATCTGTCGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-1297s1c1
Sequence:CCGGCCGAATGCCTAATTTACAGAACTCGAGTTCTGTAAATTAGGCATTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-863s1c1
Sequence:CCGGCAACTCTGTGTGAAGGATAATCTCGAGATTATCCTTCACACAGAGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005966.3-3583s21c1
Sequence:CCGGCAGATCACTGTCACGTATATACTCGAGTATATACGTGACAGTGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-1844s21c1
Sequence:CCGGGAATCTCCGAATGCCTAATTTCTCGAGAAATTAGGCATTCGGAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-1796s21c1
Sequence:CCGGTAACGGCTTGACTTCCGATAACTCGAGTTATCGGAAGTCAAGCCGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-1465s21c1
Sequence:CCGGTTGCCTTGGCTCGACAGATTTCTCGAGAAATCTGTCGAGCCAAGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-894s21c1
Sequence:CCGGGGAATATCCTGCAGTAGTTATCTCGAGATAACTACTGCAGGATATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005966
VALIDATED
NAB1 MISSION shRNA shRNA Plasmid DNA
NGFI-A binding protein 1 (EGR1 binding protein 1)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-746s1c1
Sequence:CCGGCCACACAAAGAGGAGGAAATTCTCGAGAATTTCCTCCTCTTTGTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-351s1c1
Sequence:CCGGGCAGTAGTTATGAAAGGAGTACTCGAGTACTCCTTTCATAACTACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-920s1c1
Sequence:CCGGGCTCGACAGATTTCTCGAGAACTCGAGTTCTCGAGAAATCTGTCGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-1297s1c1
Sequence:CCGGCCGAATGCCTAATTTACAGAACTCGAGTTCTGTAAATTAGGCATTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-863s1c1
Sequence:CCGGCAACTCTGTGTGAAGGATAATCTCGAGATTATCCTTCACACAGAGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005966.3-3583s21c1
Sequence:CCGGCAGATCACTGTCACGTATATACTCGAGTATATACGTGACAGTGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-1844s21c1
Sequence:CCGGGAATCTCCGAATGCCTAATTTCTCGAGAAATTAGGCATTCGGAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-1796s21c1
Sequence:CCGGTAACGGCTTGACTTCCGATAACTCGAGTTATCGGAAGTCAAGCCGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-1465s21c1
Sequence:CCGGTTGCCTTGGCTCGACAGATTTCTCGAGAAATCTGTCGAGCCAAGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-894s21c1
Sequence:CCGGGGAATATCCTGCAGTAGTTATCTCGAGATAACTACTGCAGGATATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005966
VALIDATED
NAB1 MISSION shRNA Lentiviral Transduction Particles
NGFI-A binding protein 1 (EGR1 binding protein 1)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-746s1c1
Sequence:CCGGCCACACAAAGAGGAGGAAATTCTCGAGAATTTCCTCCTCTTTGTGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-351s1c1
Sequence:CCGGGCAGTAGTTATGAAAGGAGTACTCGAGTACTCCTTTCATAACTACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-920s1c1
Sequence:CCGGGCTCGACAGATTTCTCGAGAACTCGAGTTCTCGAGAAATCTGTCGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-1297s1c1
Sequence:CCGGCCGAATGCCTAATTTACAGAACTCGAGTTCTGTAAATTAGGCATTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005966.2-863s1c1
Sequence:CCGGCAACTCTGTGTGAAGGATAATCTCGAGATTATCCTTCACACAGAGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005966.3-3583s21c1
Sequence:CCGGCAGATCACTGTCACGTATATACTCGAGTATATACGTGACAGTGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-1844s21c1
Sequence:CCGGGAATCTCCGAATGCCTAATTTCTCGAGAAATTAGGCATTCGGAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-1796s21c1
Sequence:CCGGTAACGGCTTGACTTCCGATAACTCGAGTTATCGGAAGTCAAGCCGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-1465s21c1
Sequence:CCGGTTGCCTTGGCTCGACAGATTTCTCGAGAAATCTGTCGAGCCAAGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005966.3-894s21c1
Sequence:CCGGGGAATATCCTGCAGTAGTTATCTCGAGATAACTACTGCAGGATATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)