EMAIL THIS PAGE TO A FRIEND

NAB2

NGFI-A binding protein 2 (EGR1 binding protein 2)

137 Gene Product Result for
Synonyms: MADER
UniProtKB ID: Q15742, B2RAK3, O76006, Q14797
Gene ID:
Human(4665) Summary: This gene encodes a member of the family of NGFI-A binding (NAB) proteins, which function in the nucleus to repress transcription induced by some members of the EGR (early growth response) family of transactivators. NAB proteins can homo- or hetero-multimerize with other EGR or NAB proteins through a conserved N-terminal domain, and repress transcription through two partially redundant C-terminal domains. Transcriptional repression by the encoded protein is mediated in part by interactions with the nucleosome remodeling and deactylase (NuRD) complex. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(17937) Ngfi-A binding protein 2
Rat(314910) Ngfi-A binding protein 2
fruit fly(42897) CG5720 gene product from transcript CG5720-RA
cow(504755) NGFI-A binding protein 2 (EGR1 binding protein 2)
Horse(100052831) NGFI-A binding protein 2 (EGR1 binding protein 2)
domestic cat(101081314) NGFI-A binding protein 2 (EGR1 binding protein 2)
dog(481122) NGFI-A binding protein 2 (EGR1 binding protein 2)
chicken(100873158) NGFI-A binding protein 2
Zebrafish(100005680) NGFI-A binding protein 2 (EGR1 binding protein 2)
sheep(101121165) NGFI-A binding protein 2 (EGR1 binding protein 2)
domestic guinea pig(100726971) NGFI-A binding protein 2 (EGR1 binding protein 2)
naked mole-rat(101725107) NGFI-A binding protein 2 (EGR1 binding protein 2)
Domestic Rabbit(100341311) NGFI-A binding protein 2 (EGR1 binding protein 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008668 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008668 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008668 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005967 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005967 Rosetta Predictions human pricing
NM_001134874 Rosetta Predictions rat pricing
NM_001122895 Rosetta Predictions mouse pricing
NM_008668 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094169 predicted 2267
2 SASI_Hs01_00094172 predicted 1432
3 SASI_Hs01_00094173 predicted 1917
4 SASI_Hs01_00094174 predicted 764
5 SASI_Hs01_00094175 predicted 624
6 SASI_Hs01_00094176 predicted 2372
7 SASI_Hs01_00094177 predicted 692
8 SASI_Hs01_00094178 predicted 1947
9 SASI_Hs02_00340642 predicted 1272
10 SASI_Hs02_00340643 predicted 1308
11 SASI_Hs01_00094170 predicted 2237
12 SASI_Hs01_00094171 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134874 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258904 predicted 2144
2 SASI_Rn02_00258905 predicted 1812
3 SASI_Rn02_00258906 predicted 1145
4 SASI_Rn02_00258907 predicted 2103
5 SASI_Rn02_00258908 predicted 1359
6 SASI_Rn02_00258909 predicted 2043
7 SASI_Rn02_00258910 predicted 1220
8 SASI_Rn02_00258911 predicted 1144
9 SASI_Rn02_00258912 predicted 480
10 SASI_Rn02_00258913 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309559 predicted 1254
2 SASI_Mm02_00309560 predicted 1184
3 SASI_Mm02_00309561 predicted 1295
4 SASI_Mm02_00309562 predicted 635
5 SASI_Mm02_00309563 predicted 1298
6 SASI_Mm02_00309564 predicted 664
7 SASI_Mm02_00309565 predicted 1270
8 SASI_Mm02_00309566 predicted 1262
9 SASI_Mm02_00309567 predicted 1232
10 SASI_Mm02_00309568 predicted 640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008668 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079225 predicted 1263
2 SASI_Mm02_00314424 predicted 1190
3 SASI_Mm01_00079228 predicted 1292
4 SASI_Mm01_00079230 predicted 634
5 SASI_Mm02_00314425 predicted 1300
6 SASI_Mm02_00314426 predicted 663
7 SASI_Mm02_00314427 predicted 1276
8 SASI_Mm02_00314428 predicted 1258
9 SASI_Mm02_00314429 predicted 1231
10 SASI_Mm02_00314430 predicted 641
11 SASI_Mm01_00079224 predicted 530
12 SASI_Mm01_00079226 predicted 1006
13 SASI_Mm01_00079227 predicted 537
14 SASI_Mm01_00079229 predicted 1014
15 SASI_Mm01_00079231 predicted 1102
16 SASI_Mm01_00079232 predicted 1373
17 SASI_Mm01_00079233 predicted 1834
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008668
VALIDATED
NAB2 MISSION shRNA Bacterial Glycerol Stock
NGFI-A binding protein 2 (EGR1 binding protein 2)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-2337s21c1
Sequence:CCGGAGTTTGCCCACCCGTTCTTATCTCGAGATAAGAACGGGTGGGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-993s21c1
Sequence:CCGGGAGAGGATCTTCCGGAGTTTCCTCGAGGAAACTCCGGAAGATCCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-1040s21c1
Sequence:CCGGATCCCTGTTGAAGCTGAATAACTCGAGTTATTCAGCTTCAACAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-1298s21c1
Sequence:CCGGCCGAGAGAGCACCTATCTTTCCTCGAGGAAAGATAGGTGCTCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-957s21c1
Sequence:CCGGGAACCAGAGATGGTGCGAATGCTCGAGCATTCGCACCATCTCTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008668.1-2263s1c1
Sequence:CCGGCGTGCTTCTAGTTTGTTTCTTCTCGAGAAGAAACAAACTAGAAGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-1763s1c1
Sequence:CCGGAGCGTTAAAGTGGAGGCAGAACTCGAGTTCTGCCTCCACTTTAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-1309s1c1
Sequence:CCGGCAGGCTTCACTCTGAAGAATTCTCGAGAATTCTTCAGAGTGAAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-709s1c1
Sequence:CCGGCCTCGAACTTGGAGAGAAGTTCTCGAGAACTTCTCTCCAAGTTCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-1308s1c1
Sequence:CCGGCCAGGCTTCACTCTGAAGAATCTCGAGATTCTTCAGAGTGAAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008668
VALIDATED
NAB2 MISSION shRNA shRNA Plasmid DNA
NGFI-A binding protein 2 (EGR1 binding protein 2)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-2337s21c1
Sequence:CCGGAGTTTGCCCACCCGTTCTTATCTCGAGATAAGAACGGGTGGGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-993s21c1
Sequence:CCGGGAGAGGATCTTCCGGAGTTTCCTCGAGGAAACTCCGGAAGATCCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-1040s21c1
Sequence:CCGGATCCCTGTTGAAGCTGAATAACTCGAGTTATTCAGCTTCAACAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-1298s21c1
Sequence:CCGGCCGAGAGAGCACCTATCTTTCCTCGAGGAAAGATAGGTGCTCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-957s21c1
Sequence:CCGGGAACCAGAGATGGTGCGAATGCTCGAGCATTCGCACCATCTCTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008668.1-2263s1c1
Sequence:CCGGCGTGCTTCTAGTTTGTTTCTTCTCGAGAAGAAACAAACTAGAAGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-1763s1c1
Sequence:CCGGAGCGTTAAAGTGGAGGCAGAACTCGAGTTCTGCCTCCACTTTAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-1309s1c1
Sequence:CCGGCAGGCTTCACTCTGAAGAATTCTCGAGAATTCTTCAGAGTGAAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-709s1c1
Sequence:CCGGCCTCGAACTTGGAGAGAAGTTCTCGAGAACTTCTCTCCAAGTTCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-1308s1c1
Sequence:CCGGCCAGGCTTCACTCTGAAGAATCTCGAGATTCTTCAGAGTGAAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008668
VALIDATED
NAB2 MISSION shRNA Lentiviral Transduction Particles
NGFI-A binding protein 2 (EGR1 binding protein 2)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238252    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-2337s21c1
Sequence:CCGGAGTTTGCCCACCCGTTCTTATCTCGAGATAAGAACGGGTGGGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-993s21c1
Sequence:CCGGGAGAGGATCTTCCGGAGTTTCCTCGAGGAAACTCCGGAAGATCCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-1040s21c1
Sequence:CCGGATCCCTGTTGAAGCTGAATAACTCGAGTTATTCAGCTTCAACAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-1298s21c1
Sequence:CCGGCCGAGAGAGCACCTATCTTTCCTCGAGGAAAGATAGGTGCTCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008668.2-957s21c1
Sequence:CCGGGAACCAGAGATGGTGCGAATGCTCGAGCATTCGCACCATCTCTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096349    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008668.1-2263s1c1
Sequence:CCGGCGTGCTTCTAGTTTGTTTCTTCTCGAGAAGAAACAAACTAGAAGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-1763s1c1
Sequence:CCGGAGCGTTAAAGTGGAGGCAGAACTCGAGTTCTGCCTCCACTTTAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-1309s1c1
Sequence:CCGGCAGGCTTCACTCTGAAGAATTCTCGAGAATTCTTCAGAGTGAAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-709s1c1
Sequence:CCGGCCTCGAACTTGGAGAGAAGTTCTCGAGAACTTCTCTCCAAGTTCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008668.1-1308s1c1
Sequence:CCGGCCAGGCTTCACTCTGAAGAATCTCGAGATTCTTCAGAGTGAAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005967
NAB2 MISSION shRNA Bacterial Glycerol Stock
NGFI-A binding protein 2 (EGR1 binding protein 2)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005967.3-1370s21c1
Sequence:CCGGTGAGGGACAACACGCTCTTATCTCGAGATAAGAGCGTGTTGTCCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005967.3-1173s21c1
Sequence:GTACCGGATCCCTGCTAAAGCTGAATAACTCGAGTTATTCAGCTTTAGCAGGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005967.3-2241s21c1
Sequence:CCGGACACACTCCCATTCTCTTTAGCTCGAGCTAAAGAGAATGGGAGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005967.3-1251s21c1
Sequence:CCGGGGAAGAGGAGATCCGCAAATACTCGAGTATTTGCGGATCTCCTCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1285s1c1
Sequence:CCGGCCACTGAAGAAGCTGAAACAACTCGAGTTGTTTCAGCTTCTTCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1050s1c1
Sequence:CCGGCCGCAAATACAGCATCATCTACTCGAGTAGATGATGCTGTATTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-327s1c1
Sequence:CCGGCCTTTCCTACTATGAGACCTTCTCGAGAAGGTCTCATAGTAGGAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1059s1c1
Sequence:CCGGCAGCATCATCTATGGCCGTTTCTCGAGAAACGGCCATAGATGATGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1624s1c1
Sequence:CCGGCCTCTCGCAGAGTTCGAGGAACTCGAGTTCCTCGAACTCTGCGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005967
NAB2 MISSION shRNA shRNA Plasmid DNA
NGFI-A binding protein 2 (EGR1 binding protein 2)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005967.3-1370s21c1
Sequence:CCGGTGAGGGACAACACGCTCTTATCTCGAGATAAGAGCGTGTTGTCCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005967.3-1173s21c1
Sequence:GTACCGGATCCCTGCTAAAGCTGAATAACTCGAGTTATTCAGCTTTAGCAGGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005967.3-2241s21c1
Sequence:CCGGACACACTCCCATTCTCTTTAGCTCGAGCTAAAGAGAATGGGAGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005967.3-1251s21c1
Sequence:CCGGGGAAGAGGAGATCCGCAAATACTCGAGTATTTGCGGATCTCCTCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1285s1c1
Sequence:CCGGCCACTGAAGAAGCTGAAACAACTCGAGTTGTTTCAGCTTCTTCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1050s1c1
Sequence:CCGGCCGCAAATACAGCATCATCTACTCGAGTAGATGATGCTGTATTTGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-327s1c1
Sequence:CCGGCCTTTCCTACTATGAGACCTTCTCGAGAAGGTCTCATAGTAGGAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1059s1c1
Sequence:CCGGCAGCATCATCTATGGCCGTTTCTCGAGAAACGGCCATAGATGATGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1624s1c1
Sequence:CCGGCCTCTCGCAGAGTTCGAGGAACTCGAGTTCCTCGAACTCTGCGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005967
NAB2 MISSION shRNA Lentiviral Transduction Particles
NGFI-A binding protein 2 (EGR1 binding protein 2)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005967.3-1370s21c1
Sequence:CCGGTGAGGGACAACACGCTCTTATCTCGAGATAAGAGCGTGTTGTCCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005967.3-1173s21c1
Sequence:GTACCGGATCCCTGCTAAAGCTGAATAACTCGAGTTATTCAGCTTTAGCAGGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230292    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005967.3-2241s21c1
Sequence:CCGGACACACTCCCATTCTCTTTAGCTCGAGCTAAAGAGAATGGGAGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005967.3-1251s21c1
Sequence:CCGGGGAAGAGGAGATCCGCAAATACTCGAGTATTTGCGGATCTCCTCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1285s1c1
Sequence:CCGGCCACTGAAGAAGCTGAAACAACTCGAGTTGTTTCAGCTTCTTCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1050s1c1
Sequence:CCGGCCGCAAATACAGCATCATCTACTCGAGTAGATGATGCTGTATTTGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-327s1c1
Sequence:CCGGCCTTTCCTACTATGAGACCTTCTCGAGAAGGTCTCATAGTAGGAAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1059s1c1
Sequence:CCGGCAGCATCATCTATGGCCGTTTCTCGAGAAACGGCCATAGATGATGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005967.2-1624s1c1
Sequence:CCGGCCTCTCGCAGAGTTCGAGGAACTCGAGTTCCTCGAACTCTGCGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)