EMAIL THIS PAGE TO A FRIEND

NABP1

nucleic acid binding protein 1

140 Gene Product Result for
Synonyms: OBFC2A SOSS-B2 SSB2
UniProtKB ID: Q96AH0, Q658Y8, Q9H5X6
Gene ID:
Human(64859) Summary: Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]
Mouse(109019) nucleic acid binding protein 1
Rat(363227) nucleic acid binding protein 1
naked mole-rat(101717425) nucleic acid binding protein 1
domestic guinea pig(100729308) nucleic acid binding protein 1
sheep(101118080) nucleic acid binding protein 1
domestic cat(101084815) nucleic acid binding protein 1
cow(613474) oligonucleotide/oligosaccharide-binding fold containing 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022837 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022837 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022837 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001031716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031716 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031716 Rosetta Predictions human pricing
NM_001014216 Rosetta Predictions rat pricing
NM_028696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183492 predicted 614
2 SASI_Hs01_00183493 predicted 978
3 SASI_Hs01_00183494 predicted 289
4 SASI_Hs01_00183495 predicted 924
5 SASI_Hs01_00183496 predicted 473
6 SASI_Hs01_00183497 predicted 742
7 SASI_Hs01_00183498 predicted 988
8 SASI_Hs01_00183499 predicted 325
9 SASI_Hs01_00183500 predicted 629
10 SASI_Hs01_00183501 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108914 predicted 411
2 SASI_Rn01_00108915 predicted 416
3 SASI_Rn01_00108916 predicted 328
4 SASI_Rn01_00108918 predicted 716
5 SASI_Rn01_00108919 predicted 739
6 SASI_Rn01_00108920 predicted 220
7 SASI_Rn01_00108921 predicted 392
8 SASI_Rn02_00201750 predicted 345
9 SASI_Rn02_00201751 predicted 607
10 SASI_Rn02_00201752 predicted 513
11 SASI_Rn01_00108917 predicted 798
12 SASI_Rn01_00108922 predicted 279
13 SASI_Rn01_00108923 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334239 predicted 712
2 SASI_Mm01_00147211 predicted 619
3 SASI_Mm01_00147212 predicted 1086
4 SASI_Mm01_00147213 predicted 516
5 SASI_Mm01_00147214 predicted 691
6 SASI_Mm01_00147215 predicted 912
7 SASI_Mm01_00147216 predicted 642
8 SASI_Mm01_00147217 predicted 880
9 SASI_Mm01_00147218 predicted 809
10 SASI_Mm02_00334240 predicted 1028
11 SASI_Mm01_00147210 predicted 1024
12 SASI_Mm01_00147219 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028696
VALIDATED
NABP1 MISSION shRNA Bacterial Glycerol Stock
nucleic acid binding protein 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028696.1-613s1c1
Sequence:CCGGGATCCTGCAAAGTAGCTGATACTCGAGTATCAGCTACTTTGCAGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028696.1-957s1c1
Sequence:CCGGCTTCCATATGGCAGAAGCAATCTCGAGATTGCTTCTGCCATATGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028696.1-1495s1c1
Sequence:CCGGGCCAGAAACTTGGACAGCATTCTCGAGAATGCTGTCCAAGTTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028696.1-634s1c1
Sequence:CCGGGAACGGGAAGCATCACTATTTCTCGAGAAATAGTGATGCTTCCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028696.1-1251s1c1
Sequence:CCGGGCTCAGTTACATCCTATTGAACTCGAGTTCAATAGGATGTAACTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028696.1-1009s1c1
Sequence:CCGGGAACACCTAGTAGTCAAACATCTCGAGATGTTTGACTACTAGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028696.1-1006s1c1
Sequence:CCGGCAGGAACACCTAGTAGTCAAACTCGAGTTTGACTACTAGGTGTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028696.1-812s1c1
Sequence:CCGGGCCAAATTTCAGTGAGCCAAACTCGAGTTTGGCTCACTGAAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028696.3-730s1c1
Sequence:CCGGGAAAGGATGCCTGACACTTTACTCGAGTAAAGTGTCAGGCATCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-632s21c1
Sequence:CCGGAGAACGGGAAGCATCACTATTCTCGAGAATAGTGATGCTTCCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028696.3-1364s21c1
Sequence:CCGGCTTAAGACACCAGCTTATATACTCGAGTATATAAGCTGGTGTCTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-1006s21c1
Sequence:CCGGAGGAACACCTAGTAGTCAAACCTCGAGGTTTGACTACTAGGTGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-822s21c1
Sequence:CCGGGTGAGCCAAACCCAGATTATACTCGAGTATAATCTGGGTTTGGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-1054s21c1
Sequence:CCGGAGATCCGAGGAGAGCCTTTAACTCGAGTTAAAGGCTCTCCTCGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028696
VALIDATED
NABP1 MISSION shRNA shRNA Plasmid DNA
nucleic acid binding protein 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028696.1-613s1c1
Sequence:CCGGGATCCTGCAAAGTAGCTGATACTCGAGTATCAGCTACTTTGCAGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028696.1-957s1c1
Sequence:CCGGCTTCCATATGGCAGAAGCAATCTCGAGATTGCTTCTGCCATATGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028696.1-1495s1c1
Sequence:CCGGGCCAGAAACTTGGACAGCATTCTCGAGAATGCTGTCCAAGTTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028696.1-634s1c1
Sequence:CCGGGAACGGGAAGCATCACTATTTCTCGAGAAATAGTGATGCTTCCCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028696.1-1251s1c1
Sequence:CCGGGCTCAGTTACATCCTATTGAACTCGAGTTCAATAGGATGTAACTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028696.1-1009s1c1
Sequence:CCGGGAACACCTAGTAGTCAAACATCTCGAGATGTTTGACTACTAGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028696.1-1006s1c1
Sequence:CCGGCAGGAACACCTAGTAGTCAAACTCGAGTTTGACTACTAGGTGTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028696.1-812s1c1
Sequence:CCGGGCCAAATTTCAGTGAGCCAAACTCGAGTTTGGCTCACTGAAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028696.3-730s1c1
Sequence:CCGGGAAAGGATGCCTGACACTTTACTCGAGTAAAGTGTCAGGCATCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-632s21c1
Sequence:CCGGAGAACGGGAAGCATCACTATTCTCGAGAATAGTGATGCTTCCCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028696.3-1364s21c1
Sequence:CCGGCTTAAGACACCAGCTTATATACTCGAGTATATAAGCTGGTGTCTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-1006s21c1
Sequence:CCGGAGGAACACCTAGTAGTCAAACCTCGAGGTTTGACTACTAGGTGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-822s21c1
Sequence:CCGGGTGAGCCAAACCCAGATTATACTCGAGTATAATCTGGGTTTGGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-1054s21c1
Sequence:CCGGAGATCCGAGGAGAGCCTTTAACTCGAGTTAAAGGCTCTCCTCGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028696
VALIDATED
NABP1 MISSION shRNA Lentiviral Transduction Particles
nucleic acid binding protein 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028696.1-613s1c1
Sequence:CCGGGATCCTGCAAAGTAGCTGATACTCGAGTATCAGCTACTTTGCAGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028696.1-957s1c1
Sequence:CCGGCTTCCATATGGCAGAAGCAATCTCGAGATTGCTTCTGCCATATGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181661    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028696.1-1495s1c1
Sequence:CCGGGCCAGAAACTTGGACAGCATTCTCGAGAATGCTGTCCAAGTTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028696.1-634s1c1
Sequence:CCGGGAACGGGAAGCATCACTATTTCTCGAGAAATAGTGATGCTTCCCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176936    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028696.1-1251s1c1
Sequence:CCGGGCTCAGTTACATCCTATTGAACTCGAGTTCAATAGGATGTAACTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028696.1-1009s1c1
Sequence:CCGGGAACACCTAGTAGTCAAACATCTCGAGATGTTTGACTACTAGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028696.1-1006s1c1
Sequence:CCGGCAGGAACACCTAGTAGTCAAACTCGAGTTTGACTACTAGGTGTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028696.1-812s1c1
Sequence:CCGGGCCAAATTTCAGTGAGCCAAACTCGAGTTTGGCTCACTGAAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028696.3-730s1c1
Sequence:CCGGGAAAGGATGCCTGACACTTTACTCGAGTAAAGTGTCAGGCATCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-632s21c1
Sequence:CCGGAGAACGGGAAGCATCACTATTCTCGAGAATAGTGATGCTTCCCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028696.3-1364s21c1
Sequence:CCGGCTTAAGACACCAGCTTATATACTCGAGTATATAAGCTGGTGTCTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-1006s21c1
Sequence:CCGGAGGAACACCTAGTAGTCAAACCTCGAGGTTTGACTACTAGGTGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-822s21c1
Sequence:CCGGGTGAGCCAAACCCAGATTATACTCGAGTATAATCTGGGTTTGGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028696.3-1054s21c1
Sequence:CCGGAGATCCGAGGAGAGCCTTTAACTCGAGTTAAAGGCTCTCCTCGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022837
NABP1 MISSION shRNA Bacterial Glycerol Stock
nucleic acid binding protein 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022837.1-827s1c1
Sequence:CCGGCTACCCTGGTAATGATCTCCACTCGAGTGGAGATCATTACCAGGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-818s1c1
Sequence:CCGGCATACACTACTACCCTGGTAACTCGAGTTACCAGGGTAGTAGTGTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-725s1c1
Sequence:CCGGGAAAGGATGTCTGACACTTTACTCGAGTAAAGTGTCAGACATCCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-687s1c1
Sequence:CCGGGATATTATTCGGTTGACCAGACTCGAGTCTGGTCAACCGAATAATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-607s1c1
Sequence:CCGGGATCGTGCAAAGTAGCAGATACTCGAGTATCTGCTACTTTGCACGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-600s1c1
Sequence:CCGGGAAGTGAGATCGTGCAAAGTACTCGAGTACTTTGCACGATCTCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022837
NABP1 MISSION shRNA shRNA Plasmid DNA
nucleic acid binding protein 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022837.1-827s1c1
Sequence:CCGGCTACCCTGGTAATGATCTCCACTCGAGTGGAGATCATTACCAGGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-818s1c1
Sequence:CCGGCATACACTACTACCCTGGTAACTCGAGTTACCAGGGTAGTAGTGTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-725s1c1
Sequence:CCGGGAAAGGATGTCTGACACTTTACTCGAGTAAAGTGTCAGACATCCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-687s1c1
Sequence:CCGGGATATTATTCGGTTGACCAGACTCGAGTCTGGTCAACCGAATAATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-607s1c1
Sequence:CCGGGATCGTGCAAAGTAGCAGATACTCGAGTATCTGCTACTTTGCACGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-600s1c1
Sequence:CCGGGAAGTGAGATCGTGCAAAGTACTCGAGTACTTTGCACGATCTCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022837
NABP1 MISSION shRNA Lentiviral Transduction Particles
nucleic acid binding protein 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137341    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022837.1-827s1c1
Sequence:CCGGCTACCCTGGTAATGATCTCCACTCGAGTGGAGATCATTACCAGGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-818s1c1
Sequence:CCGGCATACACTACTACCCTGGTAACTCGAGTTACCAGGGTAGTAGTGTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-725s1c1
Sequence:CCGGGAAAGGATGTCTGACACTTTACTCGAGTAAAGTGTCAGACATCCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-687s1c1
Sequence:CCGGGATATTATTCGGTTGACCAGACTCGAGTCTGGTCAACCGAATAATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-607s1c1
Sequence:CCGGGATCGTGCAAAGTAGCAGATACTCGAGTATCTGCTACTTTGCACGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022837.1-600s1c1
Sequence:CCGGGAAGTGAGATCGTGCAAAGTACTCGAGTACTTTGCACGATCTCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031716
NABP1 MISSION shRNA Bacterial Glycerol Stock
nucleic acid binding protein 1
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000422905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031716.2-1526s21c1
Sequence:CCGGTGTCAATGCTAGCAGTAATTTCTCGAGAAATTACTGCTAGCATTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031716.2-658s21c1
Sequence:CCGGGATGAGATCGGAGGTCTTATACTCGAGTATAAGACCTCCGATCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031716
NABP1 MISSION shRNA shRNA Plasmid DNA
nucleic acid binding protein 1
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000422905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031716.2-1526s21c1
Sequence:CCGGTGTCAATGCTAGCAGTAATTTCTCGAGAAATTACTGCTAGCATTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031716.2-658s21c1
Sequence:CCGGGATGAGATCGGAGGTCTTATACTCGAGTATAAGACCTCCGATCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031716
NABP1 MISSION shRNA Lentiviral Transduction Particles
nucleic acid binding protein 1
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000422905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031716.2-1526s21c1
Sequence:CCGGTGTCAATGCTAGCAGTAATTTCTCGAGAAATTACTGCTAGCATTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031716.2-658s21c1
Sequence:CCGGGATGAGATCGGAGGTCTTATACTCGAGTATAAGACCTCCGATCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)