EMAIL THIS PAGE TO A FRIEND

NABP2

nucleic acid binding protein 2

62 Gene Product Result for
Synonyms: OBFC2B SOSS-B1 SSB1 hSSB1
UniProtKB ID: Q9BQ15, A6NDF8, Q6XYC8
Gene ID:
Human(79035) Summary: Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2B, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]
Mouse(69917) nucleic acid binding protein 2
Rat(362813) nucleic acid binding protein 2
cow(533842) oligonucleotide/oligosaccharide-binding fold containing 2B
domestic cat(101097325) nucleic acid binding protein 2
sheep(101102894) nucleic acid binding protein 2
domestic guinea pig(100734284) nucleic acid binding protein 2
naked mole-rat(101712684) nucleic acid binding protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024068 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024068 Rosetta Predictions human pricing
NM_001034939 Rosetta Predictions rat pricing
NM_027257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233431 predicted 370
2 SASI_Hs01_00233432 predicted 246
3 SASI_Hs01_00233433 predicted 366
4 SASI_Hs01_00233434 predicted 416
5 SASI_Hs01_00233436 predicted 339
6 SASI_Hs01_00233437 predicted 755
7 SASI_Hs01_00233439 predicted 576
8 SASI_Hs01_00233440 predicted 487
9 SASI_Hs02_00356530 predicted 514
10 SASI_Hs02_00356531 predicted 285
11 SASI_Hs01_00233435 predicted 429
12 SASI_Hs01_00233438 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068979 predicted 427
2 SASI_Rn01_00068980 predicted 560
3 SASI_Rn01_00068981 predicted 428
4 SASI_Rn01_00068982 predicted 560
5 SASI_Rn01_00068984 predicted 623
6 SASI_Rn01_00068985 predicted 836
7 SASI_Rn02_00204123 predicted 625
8 SASI_Rn01_00068986 predicted 1115
9 SASI_Rn01_00068987 predicted 626
10 SASI_Rn01_00068988 predicted 545
11 SASI_Rn01_00068983 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075513 predicted 773
2 SASI_Mm01_00075514 predicted 285
3 SASI_Mm01_00075515 predicted 807
4 SASI_Mm01_00075516 predicted 436
5 SASI_Mm01_00075517 predicted 371
6 SASI_Mm01_00075518 predicted 713
7 SASI_Mm01_00075519 predicted 617
8 SASI_Mm01_00075520 predicted 519
9 SASI_Mm01_00075521 predicted 704
10 SASI_Mm02_00331827 predicted 316
11 SASI_Mm01_00075522 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024068
VALIDATED
NABP2 MISSION shRNA Bacterial Glycerol Stock
nucleic acid binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024068.3-568s21c1
Sequence:CCGGGAACCAGAATGGGAATGGACTCTCGAGAGTCCATTCCCATTCTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024068.3-901s21c1
Sequence:CCGGCCTAATCTCATACTCCCTCATCTCGAGATGAGGGAGTATGAGATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_024068.2-578s1c1
Sequence:CCGGGAACCAGAATGGGAATGGACTCTCGAGAGTCCATTCCCATTCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024068.2-277s1c1
Sequence:CCGGGCAGCATCAATATCTCTGTCTCTCGAGAGACAGAGATATTGATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024068.3-267s21c1
Sequence:CCGGGCAGCATCAATATCTCTGTCTCTCGAGAGACAGAGATATTGATGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024068.2-567s1c1
Sequence:CCGGCCAGCCTCTGAGAACCAGAATCTCGAGATTCTGGTTCTCAGAGGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024068.3-557s21c1
Sequence:CCGGCCAGCCTCTGAGAACCAGAATCTCGAGATTCTGGTTCTCAGAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024068.2-405s1c1
Sequence:CCGGGATCTGCAGAAGATTGGAGAACTCGAGTTCTCCAATCTTCTGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024068.2-911s1c1
Sequence:CCGGCCTAATCTCATACTCCCTCATCTCGAGATGAGGGAGTATGAGATTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024068.2-346s1c1
Sequence:CCGGCCAAAGGGTACGCTTCAGTTTCTCGAGAAACTGAAGCGTACCCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024068
VALIDATED
NABP2 MISSION shRNA shRNA Plasmid DNA
nucleic acid binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024068.3-568s21c1
Sequence:CCGGGAACCAGAATGGGAATGGACTCTCGAGAGTCCATTCCCATTCTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024068.3-901s21c1
Sequence:CCGGCCTAATCTCATACTCCCTCATCTCGAGATGAGGGAGTATGAGATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_024068.2-578s1c1
Sequence:CCGGGAACCAGAATGGGAATGGACTCTCGAGAGTCCATTCCCATTCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024068.2-277s1c1
Sequence:CCGGGCAGCATCAATATCTCTGTCTCTCGAGAGACAGAGATATTGATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024068.3-267s21c1
Sequence:CCGGGCAGCATCAATATCTCTGTCTCTCGAGAGACAGAGATATTGATGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024068.2-567s1c1
Sequence:CCGGCCAGCCTCTGAGAACCAGAATCTCGAGATTCTGGTTCTCAGAGGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024068.3-557s21c1
Sequence:CCGGCCAGCCTCTGAGAACCAGAATCTCGAGATTCTGGTTCTCAGAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024068.2-405s1c1
Sequence:CCGGGATCTGCAGAAGATTGGAGAACTCGAGTTCTCCAATCTTCTGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024068.2-911s1c1
Sequence:CCGGCCTAATCTCATACTCCCTCATCTCGAGATGAGGGAGTATGAGATTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024068.2-346s1c1
Sequence:CCGGCCAAAGGGTACGCTTCAGTTTCTCGAGAAACTGAAGCGTACCCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024068
VALIDATED
NABP2 MISSION shRNA Lentiviral Transduction Particles
nucleic acid binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024068.3-568s21c1
Sequence:CCGGGAACCAGAATGGGAATGGACTCTCGAGAGTCCATTCCCATTCTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343355    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024068.3-901s21c1
Sequence:CCGGCCTAATCTCATACTCCCTCATCTCGAGATGAGGGAGTATGAGATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_024068.2-578s1c1
Sequence:CCGGGAACCAGAATGGGAATGGACTCTCGAGAGTCCATTCCCATTCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_024068.2-277s1c1
Sequence:CCGGGCAGCATCAATATCTCTGTCTCTCGAGAGACAGAGATATTGATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024068.3-267s21c1
Sequence:CCGGGCAGCATCAATATCTCTGTCTCTCGAGAGACAGAGATATTGATGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024068.2-567s1c1
Sequence:CCGGCCAGCCTCTGAGAACCAGAATCTCGAGATTCTGGTTCTCAGAGGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024068.3-557s21c1
Sequence:CCGGCCAGCCTCTGAGAACCAGAATCTCGAGATTCTGGTTCTCAGAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024068.2-405s1c1
Sequence:CCGGGATCTGCAGAAGATTGGAGAACTCGAGTTCTCCAATCTTCTGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142939    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024068.2-911s1c1
Sequence:CCGGCCTAATCTCATACTCCCTCATCTCGAGATGAGGGAGTATGAGATTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_024068.2-346s1c1
Sequence:CCGGCCAAAGGGTACGCTTCAGTTTCTCGAGAAACTGAAGCGTACCCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027257
VALIDATED
NABP2 MISSION shRNA Bacterial Glycerol Stock
nucleic acid binding protein 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027257.1-123s1c1
Sequence:CCGGGCTCAAGAATCTGAATCTTATCTCGAGATAAGATTCAGATTCTTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027257.1-227s1c1
Sequence:CCGGGCAGCATCAACATCTCAGTATCTCGAGATACTGAGATGTTGATGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-411s21c1
Sequence:CCGGTGAGCCCAATCCAGAGTATAACTCGAGTTATACTCTGGATTGGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027257.1-302s1c1
Sequence:CCGGGGTATGCTTCAGTGTTCAAAGCTCGAGCTTTGAACACTGAAGCATACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027257.1-811s21c1
Sequence:CCGGGCTTTGGGATTAGAGGATAAACTCGAGTTTATCCTCTAATCCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-190s21c1
Sequence:CCGGCACGAGGTTCGGACCTGTAAACTCGAGTTTACAGGTCCGAACCTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-388s21c1
Sequence:CCGGTATTCCGAAGTCCCTAATTTCCTCGAGGAAATTAGGGACTTCGGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-526s21c1
Sequence:CCGGTCCGAGAACCAGAACGGAAATCTCGAGATTTCCGTTCTGGTTCTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027257
VALIDATED
NABP2 MISSION shRNA shRNA Plasmid DNA
nucleic acid binding protein 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027257.1-123s1c1
Sequence:CCGGGCTCAAGAATCTGAATCTTATCTCGAGATAAGATTCAGATTCTTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027257.1-227s1c1
Sequence:CCGGGCAGCATCAACATCTCAGTATCTCGAGATACTGAGATGTTGATGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-411s21c1
Sequence:CCGGTGAGCCCAATCCAGAGTATAACTCGAGTTATACTCTGGATTGGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027257.1-302s1c1
Sequence:CCGGGGTATGCTTCAGTGTTCAAAGCTCGAGCTTTGAACACTGAAGCATACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027257.1-811s21c1
Sequence:CCGGGCTTTGGGATTAGAGGATAAACTCGAGTTTATCCTCTAATCCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-190s21c1
Sequence:CCGGCACGAGGTTCGGACCTGTAAACTCGAGTTTACAGGTCCGAACCTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-388s21c1
Sequence:CCGGTATTCCGAAGTCCCTAATTTCCTCGAGGAAATTAGGGACTTCGGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-526s21c1
Sequence:CCGGTCCGAGAACCAGAACGGAAATCTCGAGATTTCCGTTCTGGTTCTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027257
VALIDATED
NABP2 MISSION shRNA Lentiviral Transduction Particles
nucleic acid binding protein 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027257.1-123s1c1
Sequence:CCGGGCTCAAGAATCTGAATCTTATCTCGAGATAAGATTCAGATTCTTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027257.1-227s1c1
Sequence:CCGGGCAGCATCAACATCTCAGTATCTCGAGATACTGAGATGTTGATGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-411s21c1
Sequence:CCGGTGAGCCCAATCCAGAGTATAACTCGAGTTATACTCTGGATTGGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027257.1-302s1c1
Sequence:CCGGGGTATGCTTCAGTGTTCAAAGCTCGAGCTTTGAACACTGAAGCATACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027257.1-811s21c1
Sequence:CCGGGCTTTGGGATTAGAGGATAAACTCGAGTTTATCCTCTAATCCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-190s21c1
Sequence:CCGGCACGAGGTTCGGACCTGTAAACTCGAGTTTACAGGTCCGAACCTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-388s21c1
Sequence:CCGGTATTCCGAAGTCCCTAATTTCCTCGAGGAAATTAGGGACTTCGGAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027257.1-526s21c1
Sequence:CCGGTCCGAGAACCAGAACGGAAATCTCGAGATTTCCGTTCTGGTTCTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)