EMAIL THIS PAGE TO A FRIEND

NACA2

nascent polypeptide-associated complex alpha subunit 2

25 Gene Product Result for
Synonyms: ANAC NACAL
Species: Human NACA2(342538), Thale Cress NACA2(824109)
UniProtKB ID: Q9H009, Q2VIR9
Gene ID:
Thale Cress(824109) nascent polypeptide-associated complex subunit alpha-like protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199290 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199290 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199290 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU149611 MISSION® esiRNA esiRNA human NACA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_199290 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199290 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022924 predicted 460
2 SASI_Hs01_00022925 predicted 364
3 SASI_Hs01_00022926 predicted 468
4 SASI_Hs01_00022927 predicted 546
5 SASI_Hs01_00022928 predicted 363
6 SASI_Hs01_00022929 predicted 364
7 SASI_Hs01_00022930 predicted 108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199290
VALIDATED
NACA2 MISSION shRNA Bacterial Glycerol Stock
nascent polypeptide-associated complex alpha subunit 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199290.3-130s21c1
Sequence:CCGGAGGGATTGAAGAACAGGATTCCTCGAGGAATCCTGTTCTTCAATCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199290.3-462s21c1
Sequence:CCGGGTGAAGCTGTCGGAAACATTCCTCGAGGAATGTTTCCGACAGCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-552s1c1
Sequence:CCGGGTAGAAGTTAAAGACGTGAAACTCGAGTTTCACGTCTTTAACTTCTACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199290.2-618s1c1
Sequence:CCGGGCTCTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-106s1c1
Sequence:CCGGCAGCATCTGATAGTGGTGAATCTCGAGATTCACCACTATCAGATGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-567s1c1
Sequence:CCGGGTGAAATTGGTCATGTCACAACTCGAGTTGTGACATGACCAATTTCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-444s1c1
Sequence:CCGGGCGGAGAAATTCAGAGTTCAACTCGAGTTGAACTCTGAATTTCTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199290
VALIDATED
NACA2 MISSION shRNA shRNA Plasmid DNA
nascent polypeptide-associated complex alpha subunit 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199290.3-130s21c1
Sequence:CCGGAGGGATTGAAGAACAGGATTCCTCGAGGAATCCTGTTCTTCAATCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199290.3-462s21c1
Sequence:CCGGGTGAAGCTGTCGGAAACATTCCTCGAGGAATGTTTCCGACAGCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-552s1c1
Sequence:CCGGGTAGAAGTTAAAGACGTGAAACTCGAGTTTCACGTCTTTAACTTCTACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199290.2-618s1c1
Sequence:CCGGGCTCTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-106s1c1
Sequence:CCGGCAGCATCTGATAGTGGTGAATCTCGAGATTCACCACTATCAGATGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-567s1c1
Sequence:CCGGGTGAAATTGGTCATGTCACAACTCGAGTTGTGACATGACCAATTTCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-444s1c1
Sequence:CCGGGCGGAGAAATTCAGAGTTCAACTCGAGTTGAACTCTGAATTTCTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199290
VALIDATED
NACA2 MISSION shRNA Lentiviral Transduction Particles
nascent polypeptide-associated complex alpha subunit 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199290.3-130s21c1
Sequence:CCGGAGGGATTGAAGAACAGGATTCCTCGAGGAATCCTGTTCTTCAATCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199290.3-462s21c1
Sequence:CCGGGTGAAGCTGTCGGAAACATTCCTCGAGGAATGTTTCCGACAGCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-552s1c1
Sequence:CCGGGTAGAAGTTAAAGACGTGAAACTCGAGTTTCACGTCTTTAACTTCTACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_199290.2-618s1c1
Sequence:CCGGGCTCTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-106s1c1
Sequence:CCGGCAGCATCTGATAGTGGTGAATCTCGAGATTCACCACTATCAGATGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-567s1c1
Sequence:CCGGGTGAAATTGGTCATGTCACAACTCGAGTTGTGACATGACCAATTTCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199290.2-444s1c1
Sequence:CCGGGCGGAGAAATTCAGAGTTCAACTCGAGTTGAACTCTGAATTTCTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)