EMAIL THIS PAGE TO A FRIEND

NACA

nascent polypeptide-associated complex alpha subunit

96 Gene Product Result for
Synonyms: NACA1
UniProtKB ID: Q13765, F8VU71, Q3KQV4, Q53A18, Q53G46
Gene ID:
Human(4666) Summary: The protein encoded by this gene associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). NAC binds to nascent proteins as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. However, nascent proteins with an exposed signal peptide will not be bound by the encoded protein, enabling them to bind the SRP and enter the secretory pathway. This protein has been determined to be an IgE autoantigen in atopic dermatitis patients. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(17938) nascent polypeptide-associated complex alpha polypeptide
Rat(288770) nascent polypeptide-associated complex alpha subunit
Zebrafish(195823) nascent polypeptide-associated complex alpha polypeptide
chicken(396544) nascent polypeptide-associated complex alpha subunit
domestic cat(101087933) nascent polypeptide-associated complex alpha subunit
cow(513312) nascent polypeptide-associated complex alpha subunit
dog(474408) nascent polypeptide-associated complex alpha subunit
naked mole-rat(101700724) nascent polypeptide-associated complex alpha subunit
domestic guinea pig(100730848) nascent polypeptide-associated complex alpha subunit
sheep(101105899) nascent polypeptide-associated complex alpha subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005594 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013608 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013608 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013608 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001113201 Rosetta Predictions human pricing
NM_001113202 Rosetta Predictions human pricing
NM_001113203 Rosetta Predictions human pricing
NM_005594 Rosetta Predictions human pricing
NM_001105939 Rosetta Predictions rat pricing
NM_001113199 Rosetta Predictions mouse pricing
NM_013608 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325605 predicted 887
2 SASI_Hs02_00325606 predicted 683
3 SASI_Hs02_00325607 predicted 691
4 SASI_Hs02_00325608 predicted 878
5 SASI_Hs02_00325609 predicted 724
6 SASI_Hs02_00325610 predicted 863
7 SASI_Hs02_00325611 predicted 684
8 SASI_Hs02_00325612 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325613 predicted 814
2 SASI_Hs02_00325614 predicted 622
3 SASI_Hs02_00325615 predicted 620
4 SASI_Hs02_00325616 predicted 816
5 SASI_Hs02_00325617 predicted 660
6 SASI_Hs02_00325618 predicted 800
7 SASI_Hs02_00325619 predicted 619
8 SASI_Hs02_00325620 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325621 predicted 6404
2 SASI_Hs02_00325622 predicted 6210
3 SASI_Hs02_00325623 predicted 6214
4 SASI_Hs02_00325624 predicted 6406
5 SASI_Hs02_00325625 predicted 6244
6 SASI_Hs02_00325626 predicted 6390
7 SASI_Hs02_00325627 predicted 6210
8 SASI_Hs02_00325628 predicted 6391
9 SASI_Hs02_00325629 predicted 1675
10 SASI_Hs02_00325630 predicted 2668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339899 predicted 859
2 SASI_Hs01_00024837 predicted 661
3 SASI_Hs02_00339900 predicted 664
4 SASI_Hs02_00339901 predicted 855
5 SASI_Hs02_00339902 predicted 696
6 SASI_Hs02_00339903 predicted 839
7 SASI_Hs01_00024838 predicted 658
8 SASI_Hs02_00339904 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214032 predicted 514
2 SASI_Rn02_00214033 predicted 328
3 SASI_Rn02_00214034 predicted 282
4 SASI_Rn02_00214035 predicted 389
5 SASI_Rn02_00214036 predicted 377
6 SASI_Rn02_00214037 predicted 348
7 SASI_Rn02_00214038 predicted 292
8 SASI_Rn02_00214039 predicted 212
9 SASI_Rn02_00214040 predicted 377
10 SASI_Rn02_00214041 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113199 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307213 predicted 6694
2 SASI_Mm02_00307214 predicted 6526
3 SASI_Mm02_00307215 predicted 6718
4 SASI_Mm02_00307216 predicted 6689
5 SASI_Mm02_00307217 predicted 6694
6 SASI_Mm02_00307218 predicted 6596
7 SASI_Mm02_00307219 predicted 6723
8 SASI_Mm02_00307220 predicted 6605
9 SASI_Mm02_00307221 predicted 6634
10 SASI_Mm02_00307222 predicted 6688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322353 predicted 775
2 SASI_Mm01_00049282 predicted 607
3 SASI_Mm02_00322354 predicted 803
4 SASI_Mm02_00322355 predicted 778
5 SASI_Mm02_00322356 predicted 776
6 SASI_Mm02_00322357 predicted 679
7 SASI_Mm02_00322358 predicted 801
8 SASI_Mm02_00322359 predicted 689
9 SASI_Mm02_00322360 predicted 711
10 SASI_Mm02_00322361 predicted 781
11 SASI_Mm01_00049283 predicted 335
12 SASI_Mm01_00049284 predicted 334
13 SASI_Mm01_00049285 predicted 658
14 SASI_Mm01_00049286 predicted 304
15 SASI_Mm01_00049287 predicted 304
16 SASI_Mm01_00049288 predicted 354
17 SASI_Mm01_00049289 predicted 315
18 SASI_Mm01_00049290 predicted 342
19 SASI_Mm01_00049291 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005594
VALIDATED
NACA MISSION shRNA Bacterial Glycerol Stock
nascent polypeptide-associated complex alpha subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-415s1c1
Sequence:CCGGCCAGAGCTTGAAGAACAGGATCTCGAGATCCTGTTCTTCAAGCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-652s1c1
Sequence:CCGGCCTGCTTCAGATACTTACATACTCGAGTATGTAAGTATCTGAAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-901s1c1
Sequence:CCGGGCCCTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-544s1c1
Sequence:CCGGGCTATGTCCAAACTGGGTCTTCTCGAGAAGACCCAGTTTGGACATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-648s1c1
Sequence:CCGGGAGCCCTGCTTCAGATACTTACTCGAGTAAGTATCTGAAGCAGGGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-558s21c1
Sequence:CCGGGCTATGTCCAAACTGGGTCTTCTCGAGAAGACCCAGTTTGGACATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-429s21c1
Sequence:CCGGCCAGAGCTTGAAGAACAGGATCTCGAGATCCTGTTCTTCAAGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-915s21c1
Sequence:CCGGGCCCTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-662s21c1
Sequence:CCGGGAGCCCTGCTTCAGATACTTACTCGAGTAAGTATCTGAAGCAGGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005594
VALIDATED
NACA MISSION shRNA shRNA Plasmid DNA
nascent polypeptide-associated complex alpha subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-415s1c1
Sequence:CCGGCCAGAGCTTGAAGAACAGGATCTCGAGATCCTGTTCTTCAAGCTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000020999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-652s1c1
Sequence:CCGGCCTGCTTCAGATACTTACATACTCGAGTATGTAAGTATCTGAAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-901s1c1
Sequence:CCGGGCCCTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-544s1c1
Sequence:CCGGGCTATGTCCAAACTGGGTCTTCTCGAGAAGACCCAGTTTGGACATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-648s1c1
Sequence:CCGGGAGCCCTGCTTCAGATACTTACTCGAGTAAGTATCTGAAGCAGGGCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-558s21c1
Sequence:CCGGGCTATGTCCAAACTGGGTCTTCTCGAGAAGACCCAGTTTGGACATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-429s21c1
Sequence:CCGGCCAGAGCTTGAAGAACAGGATCTCGAGATCCTGTTCTTCAAGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-915s21c1
Sequence:CCGGGCCCTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-662s21c1
Sequence:CCGGGAGCCCTGCTTCAGATACTTACTCGAGTAAGTATCTGAAGCAGGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005594
VALIDATED
NACA MISSION shRNA Lentiviral Transduction Particles
nascent polypeptide-associated complex alpha subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-415s1c1
Sequence:CCGGCCAGAGCTTGAAGAACAGGATCTCGAGATCCTGTTCTTCAAGCTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000020999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-652s1c1
Sequence:CCGGCCTGCTTCAGATACTTACATACTCGAGTATGTAAGTATCTGAAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021000    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-901s1c1
Sequence:CCGGGCCCTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-544s1c1
Sequence:CCGGGCTATGTCCAAACTGGGTCTTCTCGAGAAGACCCAGTTTGGACATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005594.2-648s1c1
Sequence:CCGGGAGCCCTGCTTCAGATACTTACTCGAGTAAGTATCTGAAGCAGGGCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-558s21c1
Sequence:CCGGGCTATGTCCAAACTGGGTCTTCTCGAGAAGACCCAGTTTGGACATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-429s21c1
Sequence:CCGGCCAGAGCTTGAAGAACAGGATCTCGAGATCCTGTTCTTCAAGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-915s21c1
Sequence:CCGGGCCCTGAAGAACAACAGTAATCTCGAGATTACTGTTGTTCTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005594.4-662s21c1
Sequence:CCGGGAGCCCTGCTTCAGATACTTACTCGAGTAAGTATCTGAAGCAGGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013608
VALIDATED
NACA MISSION shRNA Bacterial Glycerol Stock
nascent polypeptide-associated complex alpha subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013608.2-528s1c1
Sequence:CCGGGCTGCTGAGAAATTCAAAGTTCTCGAGAACTTTGAATTTCTCAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-456s1c1
Sequence:CCGGCCAGCTTCAGACACCTACATACTCGAGTATGTAGGTGTCTGAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-289s1c1
Sequence:CCGGTCGATGAAGAACCTGTTAGTACTCGAGTACTAACAGGTTCTTCATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-317s1c1
Sequence:CCGGGCAGAGTCGAAGTGAGAAGAACTCGAGTTCTTCTCACTTCGACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-558s1c1
Sequence:CCGGGCTGTTTCAAACATTCAGGAACTCGAGTTCCTGAATGTTTGAAACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-903s21c1
Sequence:CCGGCAAACGTATCAAGAGCAAAGGCTCGAGCCTTTGCTCTTGATACGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013608.3-544s21c1
Sequence:CCGGGCAGAGTCGAAGTGAGAAGAACTCGAGTTCTTCTCACTTCGACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-436s21c1
Sequence:CCGGTGAGTCAGTACCAGAGCTCGACTCGAGTCGAGCTCTGGTACTGACTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-613s21c1
Sequence:CCGGTACGAGAGTCACTATCCGAAACTCGAGTTTCGGATAGTGACTCTCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-879s21c1
Sequence:CCGGACATAGAACTGGTCATGTCGCCTCGAGGCGACATGACCAGTTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013608
VALIDATED
NACA MISSION shRNA shRNA Plasmid DNA
nascent polypeptide-associated complex alpha subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013608.2-528s1c1
Sequence:CCGGGCTGCTGAGAAATTCAAAGTTCTCGAGAACTTTGAATTTCTCAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-456s1c1
Sequence:CCGGCCAGCTTCAGACACCTACATACTCGAGTATGTAGGTGTCTGAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-289s1c1
Sequence:CCGGTCGATGAAGAACCTGTTAGTACTCGAGTACTAACAGGTTCTTCATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-317s1c1
Sequence:CCGGGCAGAGTCGAAGTGAGAAGAACTCGAGTTCTTCTCACTTCGACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-558s1c1
Sequence:CCGGGCTGTTTCAAACATTCAGGAACTCGAGTTCCTGAATGTTTGAAACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-903s21c1
Sequence:CCGGCAAACGTATCAAGAGCAAAGGCTCGAGCCTTTGCTCTTGATACGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013608.3-544s21c1
Sequence:CCGGGCAGAGTCGAAGTGAGAAGAACTCGAGTTCTTCTCACTTCGACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-436s21c1
Sequence:CCGGTGAGTCAGTACCAGAGCTCGACTCGAGTCGAGCTCTGGTACTGACTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-613s21c1
Sequence:CCGGTACGAGAGTCACTATCCGAAACTCGAGTTTCGGATAGTGACTCTCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-879s21c1
Sequence:CCGGACATAGAACTGGTCATGTCGCCTCGAGGCGACATGACCAGTTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013608
VALIDATED
NACA MISSION shRNA Lentiviral Transduction Particles
nascent polypeptide-associated complex alpha subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013608.2-528s1c1
Sequence:CCGGGCTGCTGAGAAATTCAAAGTTCTCGAGAACTTTGAATTTCTCAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-456s1c1
Sequence:CCGGCCAGCTTCAGACACCTACATACTCGAGTATGTAGGTGTCTGAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-289s1c1
Sequence:CCGGTCGATGAAGAACCTGTTAGTACTCGAGTACTAACAGGTTCTTCATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-317s1c1
Sequence:CCGGGCAGAGTCGAAGTGAGAAGAACTCGAGTTCTTCTCACTTCGACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013608.2-558s1c1
Sequence:CCGGGCTGTTTCAAACATTCAGGAACTCGAGTTCCTGAATGTTTGAAACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-903s21c1
Sequence:CCGGCAAACGTATCAAGAGCAAAGGCTCGAGCCTTTGCTCTTGATACGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013608.3-544s21c1
Sequence:CCGGGCAGAGTCGAAGTGAGAAGAACTCGAGTTCTTCTCACTTCGACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-436s21c1
Sequence:CCGGTGAGTCAGTACCAGAGCTCGACTCGAGTCGAGCTCTGGTACTGACTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-613s21c1
Sequence:CCGGTACGAGAGTCACTATCCGAAACTCGAGTTTCGGATAGTGACTCTCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013608.3-879s21c1
Sequence:CCGGACATAGAACTGGTCATGTCGCCTCGAGGCGACATGACCAGTTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)