EMAIL THIS PAGE TO A FRIEND

NACAD

NAC alpha domain containing

74 Gene Product Result for
UniProtKB ID: O15069
Gene ID:
Mouse(192950) NAC alpha domain containing
Rat(289786) NAC alpha domain containing
Zebrafish(100534969) NAC alpha domain containing
cow(531208) NAC alpha domain containing
domestic cat(101100628) NAC alpha domain containing
chicken(420409) NAC alpha domain containing
sheep(101117582) NAC alpha domain containing
domestic guinea pig(100715959) NAC alpha domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166571 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001146334 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001146334 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001146334 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU148371 MISSION® esiRNA esiRNA targeting mouse Nacad mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001126176 Rosetta Predictions human pricing
XM_001133202 Rosetta Predictions human pricing
XM_001717181 Rosetta Predictions human pricing
XM_166571 Rosetta Predictions human pricing
XM_001069804 Rosetta Predictions rat pricing
XM_214092 Rosetta Predictions rat pricing
NM_001081652 Rosetta Predictions mouse pricing
XM_109794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001126176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00382560 predicted 1765
2 SASI_Hs02_00382561 predicted 4207
3 SASI_Hs02_00382562 predicted 1967
4 SASI_Hs02_00382563 predicted 4488
5 SASI_Hs02_00382564 predicted 2252
6 SASI_Hs02_00382565 predicted 2235
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001133202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00390456 predicted 1766
2 SASI_Hs02_00390457 predicted 4210
3 SASI_Hs02_00390458 predicted 1967
4 SASI_Hs02_00390459 predicted 4484
5 SASI_Hs02_00390460 predicted 2257
6 SASI_Hs02_00390461 predicted 2234
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001717181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00415522 predicted 1765
2 SASI_Hs02_00415523 predicted 4202
3 SASI_Hs02_00415524 predicted 1965
4 SASI_Hs02_00415525 predicted 4489
5 SASI_Hs02_00415526 predicted 2256
6 SASI_Hs02_00415527 predicted 2237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_166571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299833 predicted 1774
2 SASI_Hs02_00478887 predicted 4330
3 SASI_Hs01_00299834 predicted 1969
4 SASI_Hs01_00299835 predicted 4606
5 SASI_Hs01_00299836 predicted 2257
6 SASI_Hs01_00299837 predicted 2238
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329373 predicted 2383
2 SASI_Rn02_00329374 predicted 3989
3 SASI_Rn02_00329375 predicted 1496
4 SASI_Rn02_00329376 predicted 3896
5 SASI_Rn02_00329377 predicted 1600
6 SASI_Rn02_00329378 predicted 2640
7 SASI_Rn02_00329379 predicted 3757
8 SASI_Rn02_00329380 predicted 1433
9 SASI_Rn02_00329381 predicted 2992
10 SASI_Rn02_00329382 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375131 predicted 3505
2 SASI_Rn02_00375132 predicted 3787
3 SASI_Rn02_00375133 predicted 3990
4 SASI_Rn02_00375134 predicted 3369
5 SASI_Rn02_00375135 predicted 2648
6 SASI_Rn02_00375136 predicted 3757
7 SASI_Rn02_00375137 predicted 2991
8 SASI_Rn02_00375138 predicted 3269
9 SASI_Rn02_00375139 predicted 3730
10 SASI_Rn02_00375140 predicted 3098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298803 predicted 1900
2 SASI_Mm02_00298804 predicted 2364
3 SASI_Mm02_00298805 predicted 4369
4 SASI_Mm02_00298806 predicted 2929
5 SASI_Mm02_00298807 predicted 2597
6 SASI_Mm02_00298808 predicted 3011
7 SASI_Mm02_00298809 predicted 3710
8 SASI_Mm02_00298810 predicted 2358
9 SASI_Mm02_00298811 predicted 1821
10 SASI_Mm02_00298812 predicted 1850
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_109794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279034 predicted 1913
2 SASI_Mm01_00279035 predicted 2368
3 SASI_Mm01_00279036 predicted 4376
4 SASI_Mm01_00279037 predicted 2936
5 SASI_Mm01_00279038 predicted 2606
6 SASI_Mm01_00279039 predicted 3025
7 SASI_Mm01_00279040 predicted 3720
8 SASI_Mm01_00279041 predicted 2368
9 SASI_Mm01_00279042 predicted 3353
10 SASI_Mm01_00279043 predicted 1825
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166571
NACAD MISSION shRNA Bacterial Glycerol Stock
NAC alpha domain containing
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-1384s1c1
Sequence:CCGGCAGGAATTGATCTCAGAAGTACTCGAGTACTTCTGAGATCAATTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-463s1c1
Sequence:CCGGCTGTGTTCTCAGGGTGATCTTCTCGAGAAGATCACCCTGAGAACACAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-4314s1c1
Sequence:CCGGGAAGTCCAAGAACATCCTCTTCTCGAGAAGAGGATGTTCTTGGACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-2977s1c1
Sequence:CCGGGCAGCCTTGGACCAGGTCCAACTCGAGTTGGACCTGGTCCAAGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-1684s1c1
Sequence:CCGGCCTCAGAACTTGAAGGAAGAACTCGAGTTCTTCCTTCAAGTTCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166571
NACAD MISSION shRNA shRNA Plasmid DNA
NAC alpha domain containing
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-1384s1c1
Sequence:CCGGCAGGAATTGATCTCAGAAGTACTCGAGTACTTCTGAGATCAATTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-463s1c1
Sequence:CCGGCTGTGTTCTCAGGGTGATCTTCTCGAGAAGATCACCCTGAGAACACAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-4314s1c1
Sequence:CCGGGAAGTCCAAGAACATCCTCTTCTCGAGAAGAGGATGTTCTTGGACTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-2977s1c1
Sequence:CCGGGCAGCCTTGGACCAGGTCCAACTCGAGTTGGACCTGGTCCAAGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000021037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-1684s1c1
Sequence:CCGGCCTCAGAACTTGAAGGAAGAACTCGAGTTCTTCCTTCAAGTTCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166571
NACAD MISSION shRNA Lentiviral Transduction Particles
NAC alpha domain containing
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-1384s1c1
Sequence:CCGGCAGGAATTGATCTCAGAAGTACTCGAGTACTTCTGAGATCAATTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-463s1c1
Sequence:CCGGCTGTGTTCTCAGGGTGATCTTCTCGAGAAGATCACCCTGAGAACACAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-4314s1c1
Sequence:CCGGGAAGTCCAAGAACATCCTCTTCTCGAGAAGAGGATGTTCTTGGACTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-2977s1c1
Sequence:CCGGGCAGCCTTGGACCAGGTCCAACTCGAGTTGGACCTGGTCCAAGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000021037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166571.2-1684s1c1
Sequence:CCGGCCTCAGAACTTGAAGGAAGAACTCGAGTTCTTCCTTCAAGTTCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001146334
NACAD MISSION shRNA Bacterial Glycerol Stock
NAC alpha domain containing
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000437949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-4434s21c1
Sequence:CCGGAGCCGCAGCTGAGAAGTTTAACTCGAGTTAAACTTCTCAGCTGCGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-1589s21c1
Sequence:CCGGAGGGCATCAGCGAGATCTTAGCTCGAGCTAAGATCTCGCTGATGCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-4373s21c1
Sequence:CCGGCAGACACTTATGTGGTCTTTGCTCGAGCAAAGACCACATAAGTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-4249s21c1
Sequence:CCGGGCCCGAAAGGCAATGTCAAAGCTCGAGCTTTGACATTGCCTTTCGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001146334
NACAD MISSION shRNA shRNA Plasmid DNA
NAC alpha domain containing
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000437949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-4434s21c1
Sequence:CCGGAGCCGCAGCTGAGAAGTTTAACTCGAGTTAAACTTCTCAGCTGCGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-1589s21c1
Sequence:CCGGAGGGCATCAGCGAGATCTTAGCTCGAGCTAAGATCTCGCTGATGCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-4373s21c1
Sequence:CCGGCAGACACTTATGTGGTCTTTGCTCGAGCAAAGACCACATAAGTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-4249s21c1
Sequence:CCGGGCCCGAAAGGCAATGTCAAAGCTCGAGCTTTGACATTGCCTTTCGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001146334
NACAD MISSION shRNA Lentiviral Transduction Particles
NAC alpha domain containing
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000437949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-4434s21c1
Sequence:CCGGAGCCGCAGCTGAGAAGTTTAACTCGAGTTAAACTTCTCAGCTGCGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-1589s21c1
Sequence:CCGGAGGGCATCAGCGAGATCTTAGCTCGAGCTAAGATCTCGCTGATGCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-4373s21c1
Sequence:CCGGCAGACACTTATGTGGTCTTTGCTCGAGCAAAGACCACATAAGTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001146334.1-4249s21c1
Sequence:CCGGGCCCGAAAGGCAATGTCAAAGCTCGAGCTTTGACATTGCCTTTCGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081652
NACAD MISSION shRNA Bacterial Glycerol Stock
NAC alpha domain containing
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2649s21c1
Sequence:GTACCGGATCATCTCTAACCCTACAAAGCTCGAGCTTTGTAGGGTTAGAGATGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-4697s21c1
Sequence:CCGGGACTAGAACCTCGTGACATTGCTCGAGCAATGTCACGAGGTTCTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-3332s21c1
Sequence:CCGGAGCGTGGTAGAGGCACCAAATCTCGAGATTTGGTGCCTCTACCACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2761s21c1
Sequence:CCGGCCAGTAGCATCACCTTCATTGCTCGAGCAATGAAGGTGATGCTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2455s21c1
Sequence:CCGGGCTATGGCCGTGGCTACATATCTCGAGATATGTAGCCACGGCCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-4451s21c1
Sequence:CCGGAGTCCAAGAATATCTTGTTTGCTCGAGCAAACAAGATATTCTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2028s21c1
Sequence:CCGGCCTGGTTGTAGAACAAGTATCCTCGAGGATACTTGTTCTACAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2796s21c1
Sequence:CCGGGTCAACCTCAGACCTAGAATCCTCGAGGATTCTAGGTCTGAGGTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-3288s21c1
Sequence:CCGGCAAGACCCACTCACCTCAAAGCTCGAGCTTTGAGGTGAGTGGGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-580s21c1
Sequence:CCGGCACTCATGTGATGCAGCTATTCTCGAGAATAGCTGCATCACATGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081652
NACAD MISSION shRNA shRNA Plasmid DNA
NAC alpha domain containing
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2649s21c1
Sequence:GTACCGGATCATCTCTAACCCTACAAAGCTCGAGCTTTGTAGGGTTAGAGATGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-4697s21c1
Sequence:CCGGGACTAGAACCTCGTGACATTGCTCGAGCAATGTCACGAGGTTCTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-3332s21c1
Sequence:CCGGAGCGTGGTAGAGGCACCAAATCTCGAGATTTGGTGCCTCTACCACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2761s21c1
Sequence:CCGGCCAGTAGCATCACCTTCATTGCTCGAGCAATGAAGGTGATGCTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2455s21c1
Sequence:CCGGGCTATGGCCGTGGCTACATATCTCGAGATATGTAGCCACGGCCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-4451s21c1
Sequence:CCGGAGTCCAAGAATATCTTGTTTGCTCGAGCAAACAAGATATTCTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2028s21c1
Sequence:CCGGCCTGGTTGTAGAACAAGTATCCTCGAGGATACTTGTTCTACAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2796s21c1
Sequence:CCGGGTCAACCTCAGACCTAGAATCCTCGAGGATTCTAGGTCTGAGGTTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-3288s21c1
Sequence:CCGGCAAGACCCACTCACCTCAAAGCTCGAGCTTTGAGGTGAGTGGGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-580s21c1
Sequence:CCGGCACTCATGTGATGCAGCTATTCTCGAGAATAGCTGCATCACATGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081652
NACAD MISSION shRNA Lentiviral Transduction Particles
NAC alpha domain containing
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2649s21c1
Sequence:GTACCGGATCATCTCTAACCCTACAAAGCTCGAGCTTTGTAGGGTTAGAGATGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-4697s21c1
Sequence:CCGGGACTAGAACCTCGTGACATTGCTCGAGCAATGTCACGAGGTTCTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-3332s21c1
Sequence:CCGGAGCGTGGTAGAGGCACCAAATCTCGAGATTTGGTGCCTCTACCACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2761s21c1
Sequence:CCGGCCAGTAGCATCACCTTCATTGCTCGAGCAATGAAGGTGATGCTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2455s21c1
Sequence:CCGGGCTATGGCCGTGGCTACATATCTCGAGATATGTAGCCACGGCCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253110    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-4451s21c1
Sequence:CCGGAGTCCAAGAATATCTTGTTTGCTCGAGCAAACAAGATATTCTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2028s21c1
Sequence:CCGGCCTGGTTGTAGAACAAGTATCCTCGAGGATACTTGTTCTACAACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-2796s21c1
Sequence:CCGGGTCAACCTCAGACCTAGAATCCTCGAGGATTCTAGGTCTGAGGTTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-3288s21c1
Sequence:CCGGCAAGACCCACTCACCTCAAAGCTCGAGCTTTGAGGTGAGTGGGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253111    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081652.1-580s21c1
Sequence:CCGGCACTCATGTGATGCAGCTATTCTCGAGAATAGCTGCATCACATGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)