EMAIL THIS PAGE TO A FRIEND

NACC1

nucleus accumbens associated 1, BEN and BTB (POZ) domain containing

85 Gene Product Result for
Synonyms: BEND8 BTBD14B BTBD30 NAC-1 NAC1
UniProtKB ID: Q96RE7
Gene ID:
Human(112939) Summary: This gene encodes a member of the BTB/POZ protein family. BTB/POZ proteins are involved in several cellular processes including proliferation, apoptosis and transcription regulation. The encoded protein is a transcriptional repressor that plays a role in stem cell self-renewal and pluripotency maintenance. The encoded protein also suppresses transcription of the candidate tumor suppressor Gadd45GIP1, and expression of this gene may play a role in the progression of multiple types of cancer. A pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Feb 2012]
Mouse(66830) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Rat(171454) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Zebrafish(562747) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
dog(484918) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
domestic cat(101088308) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
cow(525378) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Horse(100063244) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
domestic guinea pig(100726549) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
naked mole-rat(101724794) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
sheep(101121422) nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052876 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052876 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052876 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052876 Rosetta Predictions human pricing
NM_134413 Rosetta Predictions rat pricing
NM_025788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052876 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211951 predicted 517
2 SASI_Hs01_00211952 predicted 1051
3 SASI_Hs01_00211953 predicted 1187
4 SASI_Hs01_00211954 predicted 1478
5 SASI_Hs01_00211955 predicted 437
6 SASI_Hs01_00211956 predicted 765
7 SASI_Hs02_00361585 predicted 1188
8 SASI_Hs01_00211957 predicted 1309
9 SASI_Hs01_00211959 predicted 496
10 SASI_Hs02_00361586 predicted 1061
11 SASI_Hs01_00211958 predicted 404
12 SASI_Hs01_00211960 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078870 predicted 1547
2 SASI_Rn01_00078871 predicted 1236
3 SASI_Rn01_00078872 predicted 291
4 SASI_Rn01_00078873 predicted 721
5 SASI_Rn01_00078874 predicted 984
6 SASI_Rn01_00078875 predicted 969
7 SASI_Rn01_00078877 predicted 1125
8 SASI_Rn01_00078878 predicted 464
9 SASI_Rn02_00268008 predicted 1671
10 SASI_Rn02_00268009 predicted 1004
11 SASI_Rn01_00078869 predicted 470
12 SASI_Rn01_00078876 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151282 predicted 1013
2 SASI_Mm02_00329017 predicted 805
3 SASI_Mm01_00151283 predicted 1012
4 SASI_Mm02_00329018 predicted 512
5 SASI_Mm02_00329019 predicted 996
6 SASI_Mm02_00329020 predicted 438
7 SASI_Mm01_00151285 predicted 750
8 SASI_Mm02_00329021 predicted 1156
9 SASI_Mm01_00151288 predicted 1040
10 SASI_Mm02_00329022 predicted 326
11 SASI_Mm01_00151284 predicted 1757
12 SASI_Mm01_00151286 predicted 1612
13 SASI_Mm01_00151287 predicted 1706
14 SASI_Mm01_00151289 predicted 1773
15 SASI_Mm01_00151290 predicted 1751
16 SASI_Mm01_00151291 predicted 448
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052876
VALIDATED
NACC1 MISSION shRNA Bacterial Glycerol Stock
nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052876.2-1065s1c1
Sequence:CCGGGATCTGCAACATGTACACCATCTCGAGATGGTGTACATGTTGCAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1077s1c1
Sequence:CCGGGTACACCATGTACAGCATGATCTCGAGATCATGCTGTACATGGTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1488s1c1
Sequence:CCGGCAAGTACTACTGCCAGAACTTCTCGAGAAGTTCTGGCAGTAGTACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-4380s1c1
Sequence:CCGGCCCAAGTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1199s1c1
Sequence:CCGGCGGCTGAACTTATCAACCAGACTCGAGTCTGGTTGATAAGTTCAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1201s1c1
Sequence:CCGGGCTGAACTTATCAACCAGATTCTCGAGAATCTGGTTGATAAGTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-1284s21c1
Sequence:CCGGGACAGGCACCAACGTGTACATCTCGAGATGTACACGTTGGTGCCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-4380s21c1
Sequence:CCGGCCCAAGTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-1077s21c1
Sequence:CCGGGTACACCATGTACAGCATGATCTCGAGATCATGCTGTACATGGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-1427s21c1
Sequence:CCGGTCCGCTCTTCTACCAACGATCCTCGAGGATCGTTGGTAGAAGAGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052876.2-1199s21c1
Sequence:CCGGCGGCTGAACTTATCAACCAGACTCGAGTCTGGTTGATAAGTTCAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052876
VALIDATED
NACC1 MISSION shRNA shRNA Plasmid DNA
nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052876.2-1065s1c1
Sequence:CCGGGATCTGCAACATGTACACCATCTCGAGATGGTGTACATGTTGCAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1077s1c1
Sequence:CCGGGTACACCATGTACAGCATGATCTCGAGATCATGCTGTACATGGTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1488s1c1
Sequence:CCGGCAAGTACTACTGCCAGAACTTCTCGAGAAGTTCTGGCAGTAGTACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-4380s1c1
Sequence:CCGGCCCAAGTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1199s1c1
Sequence:CCGGCGGCTGAACTTATCAACCAGACTCGAGTCTGGTTGATAAGTTCAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1201s1c1
Sequence:CCGGGCTGAACTTATCAACCAGATTCTCGAGAATCTGGTTGATAAGTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-1284s21c1
Sequence:CCGGGACAGGCACCAACGTGTACATCTCGAGATGTACACGTTGGTGCCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-4380s21c1
Sequence:CCGGCCCAAGTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCACTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-1077s21c1
Sequence:CCGGGTACACCATGTACAGCATGATCTCGAGATCATGCTGTACATGGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-1427s21c1
Sequence:CCGGTCCGCTCTTCTACCAACGATCCTCGAGGATCGTTGGTAGAAGAGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000275454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052876.2-1199s21c1
Sequence:CCGGCGGCTGAACTTATCAACCAGACTCGAGTCTGGTTGATAAGTTCAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052876
VALIDATED
NACC1 MISSION shRNA Lentiviral Transduction Particles
nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052876.2-1065s1c1
Sequence:CCGGGATCTGCAACATGTACACCATCTCGAGATGGTGTACATGTTGCAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1077s1c1
Sequence:CCGGGTACACCATGTACAGCATGATCTCGAGATCATGCTGTACATGGTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1488s1c1
Sequence:CCGGCAAGTACTACTGCCAGAACTTCTCGAGAAGTTCTGGCAGTAGTACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122764    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-4380s1c1
Sequence:CCGGCCCAAGTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1199s1c1
Sequence:CCGGCGGCTGAACTTATCAACCAGACTCGAGTCTGGTTGATAAGTTCAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_052876.2-1201s1c1
Sequence:CCGGGCTGAACTTATCAACCAGATTCTCGAGAATCTGGTTGATAAGTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-1284s21c1
Sequence:CCGGGACAGGCACCAACGTGTACATCTCGAGATGTACACGTTGGTGCCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-4380s21c1
Sequence:CCGGCCCAAGTGAGATTGCACATTTCTCGAGAAATGTGCAATCTCACTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-1077s21c1
Sequence:CCGGGTACACCATGTACAGCATGATCTCGAGATCATGCTGTACATGGTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_052876.2-1427s21c1
Sequence:CCGGTCCGCTCTTCTACCAACGATCCTCGAGGATCGTTGGTAGAAGAGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052876.2-1199s21c1
Sequence:CCGGCGGCTGAACTTATCAACCAGACTCGAGTCTGGTTGATAAGTTCAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025788
VALIDATED
NACC1 MISSION shRNA Bacterial Glycerol Stock
nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025788.2-3153s1c1
Sequence:CCGGCGCATCCATTGTTACTGGTTTCTCGAGAAACCAGTAACAATGGATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1337s1c1
Sequence:CCGGGCTTCCTTCTTTGACCGGAATCTCGAGATTCCGGTCAAAGAAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1484s1c1
Sequence:CCGGGAGAGCGAGATGAATGCCATTCTCGAGAATGGCATTCATCTCGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1620s1c1
Sequence:CCGGGCAAGATAGAACCGGACATGACTCGAGTCATGTCCGGTTCTATCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1018s1c1
Sequence:CCGGCCGTCAGATCTGCAATATGTACTCGAGTACATATTGCAGATCTGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025788.2-1756s21c1
Sequence:CCGGCTATCACACCCTCACCTATCACTCGAGTGATAGGTGAGGGTGTGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025788.2-444s21c1
Sequence:CCGGTGAACATGGGAGACCAGTTTCCTCGAGGAAACTGGTCTCCCATGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025788.2-237s21c1
Sequence:CCGGAGCGGCTACAGGGACTATACTCTCGAGAGTATAGTCCCTGTAGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025788.2-1699s21c1
Sequence:CCGGTGAGGTTCTCCAGTAACATACCTCGAGGTATGTTACTGGAGAACCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025788.2-1484s21c1
Sequence:CCGGGAGAGCGAGATGAATGCCATTCTCGAGAATGGCATTCATCTCGCTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025788
VALIDATED
NACC1 MISSION shRNA shRNA Plasmid DNA
nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025788.2-3153s1c1
Sequence:CCGGCGCATCCATTGTTACTGGTTTCTCGAGAAACCAGTAACAATGGATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1337s1c1
Sequence:CCGGGCTTCCTTCTTTGACCGGAATCTCGAGATTCCGGTCAAAGAAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1484s1c1
Sequence:CCGGGAGAGCGAGATGAATGCCATTCTCGAGAATGGCATTCATCTCGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1620s1c1
Sequence:CCGGGCAAGATAGAACCGGACATGACTCGAGTCATGTCCGGTTCTATCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1018s1c1
Sequence:CCGGCCGTCAGATCTGCAATATGTACTCGAGTACATATTGCAGATCTGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025788.2-1756s21c1
Sequence:CCGGCTATCACACCCTCACCTATCACTCGAGTGATAGGTGAGGGTGTGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025788.2-444s21c1
Sequence:CCGGTGAACATGGGAGACCAGTTTCCTCGAGGAAACTGGTCTCCCATGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025788.2-237s21c1
Sequence:CCGGAGCGGCTACAGGGACTATACTCTCGAGAGTATAGTCCCTGTAGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025788.2-1699s21c1
Sequence:CCGGTGAGGTTCTCCAGTAACATACCTCGAGGTATGTTACTGGAGAACCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025788.2-1484s21c1
Sequence:CCGGGAGAGCGAGATGAATGCCATTCTCGAGAATGGCATTCATCTCGCTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025788
VALIDATED
NACC1 MISSION shRNA Lentiviral Transduction Particles
nucleus accumbens associated 1, BEN and BTB (POZ) domain containing
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025788.2-3153s1c1
Sequence:CCGGCGCATCCATTGTTACTGGTTTCTCGAGAAACCAGTAACAATGGATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1337s1c1
Sequence:CCGGGCTTCCTTCTTTGACCGGAATCTCGAGATTCCGGTCAAAGAAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1484s1c1
Sequence:CCGGGAGAGCGAGATGAATGCCATTCTCGAGAATGGCATTCATCTCGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1620s1c1
Sequence:CCGGGCAAGATAGAACCGGACATGACTCGAGTCATGTCCGGTTCTATCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025788.2-1018s1c1
Sequence:CCGGCCGTCAGATCTGCAATATGTACTCGAGTACATATTGCAGATCTGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304651    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025788.2-1756s21c1
Sequence:CCGGCTATCACACCCTCACCTATCACTCGAGTGATAGGTGAGGGTGTGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025788.2-444s21c1
Sequence:CCGGTGAACATGGGAGACCAGTTTCCTCGAGGAAACTGGTCTCCCATGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025788.2-237s21c1
Sequence:CCGGAGCGGCTACAGGGACTATACTCTCGAGAGTATAGTCCCTGTAGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025788.2-1699s21c1
Sequence:CCGGTGAGGTTCTCCAGTAACATACCTCGAGGTATGTTACTGGAGAACCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025788.2-1484s21c1
Sequence:CCGGGAGAGCGAGATGAATGCCATTCTCGAGAATGGCATTCATCTCGCTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)