EMAIL THIS PAGE TO A FRIEND

NACC2

NACC family member 2, BEN and BTB (POZ) domain containing

101 Gene Product Result for
Synonyms: BEND9 BTBD14 BTBD14A BTBD31
UniProtKB ID: Q96BF6
Gene ID:
Mouse(67991) nucleus accumbens associated 2, BEN and BTB (POZ) domain containing
Rat(296583) NACC family member 2, BEN and BTB (POZ) domain containing
sheep(101117835) NACC family member 2, BEN and BTB (POZ) domain containing
naked mole-rat(101721249) NACC family member 2, BEN and BTB (POZ) domain containing
domestic guinea pig(100735564) NACC family member 2, BEN and BTB (POZ) domain containing
chicken(417128) NACC family member 2, BEN and BTB (POZ) domain containing
cow(528023) NACC family member 2, BEN and BTB (POZ) domain containing
Horse(100066292) NACC family member 2, BEN and BTB (POZ) domain containing
domestic cat(101088279) NACC family member 2, BEN and BTB (POZ) domain containing
dog(491255) NACC family member 2, BEN and BTB (POZ) domain containing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026495 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026495 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026495 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144653 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144653 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144653 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU070021 MISSION® esiRNA esiRNA targeting mouse Nacc2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144653 Rosetta Predictions human pricing
XM_001058289 Rosetta Predictions rat pricing
XM_001074412 Rosetta Predictions rat pricing
XM_001074461 Rosetta Predictions rat pricing
XM_216005 Rosetta Predictions rat pricing
NM_001037098 Rosetta Predictions mouse pricing
NM_026495 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144653 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073642 predicted 1455
2 SASI_Hs01_00073643 predicted 1026
3 SASI_Hs01_00073644 predicted 1290
4 SASI_Hs01_00073645 predicted 991
5 SASI_Hs01_00073646 predicted 1402
6 SASI_Hs01_00073647 predicted 1291
7 SASI_Hs01_00073648 predicted 857
8 SASI_Hs01_00073649 predicted 1025
9 SASI_Hs01_00073650 predicted 1386
10 SASI_Hs02_00364531 predicted 1268
11 SASI_Hs01_00073651 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058289 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00289226 predicted 821
2 SASI_Rn02_00289227 predicted 1050
3 SASI_Rn02_00289228 predicted 2027
4 SASI_Rn02_00289229 predicted 427
5 SASI_Rn02_00289230 predicted 1992
6 SASI_Rn02_00289231 predicted 358
7 SASI_Rn02_00289232 predicted 1429
8 SASI_Rn02_00289233 predicted 541
9 SASI_Rn02_00289234 predicted 2010
10 SASI_Rn02_00289235 predicted 1659
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074412 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346159 predicted 1337
2 SASI_Rn02_00346160 predicted 1572
3 SASI_Rn02_00346161 predicted 2548
4 SASI_Rn02_00346162 predicted 937
5 SASI_Rn02_00346163 predicted 2505
6 SASI_Rn02_00346164 predicted 880
7 SASI_Rn02_00346165 predicted 1944
8 SASI_Rn02_00346166 predicted 1051
9 SASI_Rn02_00346167 predicted 2531
10 SASI_Rn02_00346168 predicted 2175
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074461 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346316 predicted 827
2 SASI_Rn02_00346317 predicted 1053
3 SASI_Rn02_00346318 predicted 2027
4 SASI_Rn02_00346319 predicted 427
5 SASI_Rn02_00346320 predicted 1992
6 SASI_Rn02_00346321 predicted 355
7 SASI_Rn02_00346322 predicted 1428
8 SASI_Rn02_00346323 predicted 537
9 SASI_Rn02_00346324 predicted 2014
10 SASI_Rn02_00346325 predicted 1654
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376366 predicted 1345
2 SASI_Rn02_00376367 predicted 1568
3 SASI_Rn02_00376368 predicted 2544
4 SASI_Rn02_00376369 predicted 938
5 SASI_Rn02_00376370 predicted 2504
6 SASI_Rn02_00376371 predicted 872
7 SASI_Rn02_00376372 predicted 1941
8 SASI_Rn02_00376373 predicted 1060
9 SASI_Rn02_00376374 predicted 2525
10 SASI_Rn02_00376375 predicted 2181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037098 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055483 predicted 1776
2 SASI_Mm01_00055484 predicted 1567
3 SASI_Mm01_00055485 predicted 1578
4 SASI_Mm01_00055486 predicted 1537
5 SASI_Mm01_00055487 predicted 1255
6 SASI_Mm01_00055488 predicted 1539
7 SASI_Mm01_00055490 predicted 875
8 SASI_Mm01_00055491 predicted 2506
9 SASI_Mm01_00055492 predicted 2532
10 SASI_Mm02_00289277 predicted 2221
11 SASI_Mm01_00055489 predicted 947
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026495 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148380 predicted 1256
2 SASI_Mm01_00148381 predicted 1051
3 SASI_Mm01_00148382 predicted 1054
4 SASI_Mm01_00148383 predicted 1017
5 SASI_Mm01_00148384 predicted 736
6 SASI_Mm01_00148385 predicted 1017
7 SASI_Mm01_00148387 predicted 348
8 SASI_Mm01_00148388 predicted 1986
9 SASI_Mm01_00148389 predicted 2004
10 SASI_Mm02_00330384 predicted 1701
11 SASI_Mm01_00148386 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026495
VALIDATED
NACC2 MISSION shRNA Bacterial Glycerol Stock
NACC family member 2, BEN and BTB (POZ) domain containing
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-1020s21c1
Sequence:CCGGGCAGTATGGCCAGATGTATATCTCGAGATATACATCTGGCCATACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026495.2-1410s1c1
Sequence:CCGGGAAACTGTACTGTCAGAACTTCTCGAGAAGTTCTGACAGTACAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-1646s21c1
Sequence:CCGGTGTTTGAGCAGCGCATCTATGCTCGAGCATAGATGCGCTGCTCAAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026495.3-275s21c1
Sequence:CCGGATGTGTCCATCGTGGTCAAAGCTCGAGCTTTGACCACGATGGACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-4846s21c1
Sequence:CCGGGGATCCAGCCATGAGTCTTATCTCGAGATAAGACTCATGGCTGGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-1466s21c1
Sequence:CCGGAGAGCGAGATGAACGTGATTGCTCGAGCAATCACGTTCATCTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026495.3-1020s1c1
Sequence:CCGGGCAGTATGGCCAGATGTATATCTCGAGATATACATCTGGCCATACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026495
VALIDATED
NACC2 MISSION shRNA shRNA Plasmid DNA
NACC family member 2, BEN and BTB (POZ) domain containing
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-1020s21c1
Sequence:CCGGGCAGTATGGCCAGATGTATATCTCGAGATATACATCTGGCCATACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026495.2-1410s1c1
Sequence:CCGGGAAACTGTACTGTCAGAACTTCTCGAGAAGTTCTGACAGTACAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-1646s21c1
Sequence:CCGGTGTTTGAGCAGCGCATCTATGCTCGAGCATAGATGCGCTGCTCAAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026495.3-275s21c1
Sequence:CCGGATGTGTCCATCGTGGTCAAAGCTCGAGCTTTGACCACGATGGACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-4846s21c1
Sequence:CCGGGGATCCAGCCATGAGTCTTATCTCGAGATAAGACTCATGGCTGGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-1466s21c1
Sequence:CCGGAGAGCGAGATGAACGTGATTGCTCGAGCAATCACGTTCATCTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026495.3-1020s1c1
Sequence:CCGGGCAGTATGGCCAGATGTATATCTCGAGATATACATCTGGCCATACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026495
VALIDATED
NACC2 MISSION shRNA Lentiviral Transduction Particles
NACC family member 2, BEN and BTB (POZ) domain containing
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-1020s21c1
Sequence:CCGGGCAGTATGGCCAGATGTATATCTCGAGATATACATCTGGCCATACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026495.2-1410s1c1
Sequence:CCGGGAAACTGTACTGTCAGAACTTCTCGAGAAGTTCTGACAGTACAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-1646s21c1
Sequence:CCGGTGTTTGAGCAGCGCATCTATGCTCGAGCATAGATGCGCTGCTCAAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026495.3-275s21c1
Sequence:CCGGATGTGTCCATCGTGGTCAAAGCTCGAGCTTTGACCACGATGGACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-4846s21c1
Sequence:CCGGGGATCCAGCCATGAGTCTTATCTCGAGATAAGACTCATGGCTGGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026495.3-1466s21c1
Sequence:CCGGAGAGCGAGATGAACGTGATTGCTCGAGCAATCACGTTCATCTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026495.3-1020s1c1
Sequence:CCGGGCAGTATGGCCAGATGTATATCTCGAGATATACATCTGGCCATACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144653
VALIDATED
NACC2 MISSION shRNA Bacterial Glycerol Stock
NACC family member 2, BEN and BTB (POZ) domain containing
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1624s21c1
Sequence:CCGGGTGTTCGAGCAACGCATCTACCTCGAGGTAGATGCGTTGCTCGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1397s21c1
Sequence:GTACCGGTGAACGCTGTGAAATTGTACTCTCGAGAGTACAATTTCACAGCGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_144653.3-1407s1c1
Sequence:CCGGGAAATTGTACTGTCAGAACTTCTCGAGAAGTTCTGACAGTACAATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144653.3-669s1c1
Sequence:CCGGCCGAGTAAAGCATGAAGCCATCTCGAGATGGCTTCATGCTTTACTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144653.3-1298s1c1
Sequence:CCGGCCACCTTCTTTGACAGGAACACTCGAGTGTTCCTGTCAAAGAAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144653.3-1901s21c1
Sequence:CCGGCCTATGCAGGGACCTTGTAAGCTCGAGCTTACAAGGTCCCTGCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1126s21c1
Sequence:CCGGCTCATCAGCCAGATCGGATACCTCGAGGTATCCGATCTGGCTGATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144653.3-1002s1c1
Sequence:CCGGGTACGGCCAGATGTACATCAACTCGAGTTGATGTACATCTGGCCGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1682s21c1
Sequence:CCGGTGAGAACTGACGCCGTGAATGCTCGAGCATTCACGGCGTCAGTTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144653
VALIDATED
NACC2 MISSION shRNA shRNA Plasmid DNA
NACC family member 2, BEN and BTB (POZ) domain containing
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1624s21c1
Sequence:CCGGGTGTTCGAGCAACGCATCTACCTCGAGGTAGATGCGTTGCTCGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1397s21c1
Sequence:GTACCGGTGAACGCTGTGAAATTGTACTCTCGAGAGTACAATTTCACAGCGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_144653.3-1407s1c1
Sequence:CCGGGAAATTGTACTGTCAGAACTTCTCGAGAAGTTCTGACAGTACAATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144653.3-669s1c1
Sequence:CCGGCCGAGTAAAGCATGAAGCCATCTCGAGATGGCTTCATGCTTTACTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144653.3-1298s1c1
Sequence:CCGGCCACCTTCTTTGACAGGAACACTCGAGTGTTCCTGTCAAAGAAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144653.3-1901s21c1
Sequence:CCGGCCTATGCAGGGACCTTGTAAGCTCGAGCTTACAAGGTCCCTGCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1126s21c1
Sequence:CCGGCTCATCAGCCAGATCGGATACCTCGAGGTATCCGATCTGGCTGATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144653.3-1002s1c1
Sequence:CCGGGTACGGCCAGATGTACATCAACTCGAGTTGATGTACATCTGGCCGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1682s21c1
Sequence:CCGGTGAGAACTGACGCCGTGAATGCTCGAGCATTCACGGCGTCAGTTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144653
VALIDATED
NACC2 MISSION shRNA Lentiviral Transduction Particles
NACC family member 2, BEN and BTB (POZ) domain containing
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1624s21c1
Sequence:CCGGGTGTTCGAGCAACGCATCTACCTCGAGGTAGATGCGTTGCTCGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1397s21c1
Sequence:GTACCGGTGAACGCTGTGAAATTGTACTCTCGAGAGTACAATTTCACAGCGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_144653.3-1407s1c1
Sequence:CCGGGAAATTGTACTGTCAGAACTTCTCGAGAAGTTCTGACAGTACAATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_144653.3-669s1c1
Sequence:CCGGCCGAGTAAAGCATGAAGCCATCTCGAGATGGCTTCATGCTTTACTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_144653.3-1298s1c1
Sequence:CCGGCCACCTTCTTTGACAGGAACACTCGAGTGTTCCTGTCAAAGAAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144653.3-1901s21c1
Sequence:CCGGCCTATGCAGGGACCTTGTAAGCTCGAGCTTACAAGGTCCCTGCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1126s21c1
Sequence:CCGGCTCATCAGCCAGATCGGATACCTCGAGGTATCCGATCTGGCTGATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144653.3-1002s1c1
Sequence:CCGGGTACGGCCAGATGTACATCAACTCGAGTTGATGTACATCTGGCCGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_144653.3-1682s21c1
Sequence:CCGGTGAGAACTGACGCCGTGAATGCTCGAGCATTCACGGCGTCAGTTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)