EMAIL THIS PAGE TO A FRIEND

NADK2

NAD kinase 2, mitochondrial

96 Gene Product Result for
Synonyms: C5orf33 MNADK NADKD1
UniProtKB ID: Q4G0N4, B5MC93, Q6UTX5, Q96NM0
Gene ID:
Mouse(68646) NAD kinase 2, mitochondrial
Rat(365699) NAD kinase 2, mitochondrial
Thale Cress(838766) NAD kinase 2
Zebrafish(445071) NAD kinase 2, mitochondrial
naked mole-rat(101705645) NAD kinase 2, mitochondrial
domestic guinea pig(100713468) NAD kinase 2, mitochondrial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153013 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153013 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153013 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_127934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_127934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_127934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085411 Rosetta Predictions human pricing
NM_153013 Rosetta Predictions human pricing
NM_001044252 Rosetta Predictions rat pricing
NM_001040395 Rosetta Predictions mouse pricing
NM_001085410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085411 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317625 predicted 740
2 SASI_Hs02_00317626 predicted 718
3 SASI_Hs02_00317627 predicted 1264
4 SASI_Hs02_00317628 predicted 740
5 SASI_Hs02_00317629 predicted 1327
6 SASI_Hs02_00317630 predicted 859
7 SASI_Hs02_00317631 predicted 898
8 SASI_Hs02_00317632 predicted 755
9 SASI_Hs02_00317633 predicted 650
10 SASI_Hs02_00317634 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153013 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167647 predicted 503
2 SASI_Hs01_00167648 predicted 478
3 SASI_Hs02_00366969 predicted 1032
4 SASI_Hs01_00167649 predicted 493
5 SASI_Hs02_00366970 predicted 1085
6 SASI_Hs01_00167650 predicted 625
7 SASI_Hs01_00167652 predicted 659
8 SASI_Hs01_00167653 predicted 513
9 SASI_Hs01_00167655 predicted 416
10 SASI_Hs01_00167656 predicted 675
11 SASI_Hs01_00167651 predicted 674
12 SASI_Hs01_00167654 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044252 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205247 predicted 486
2 SASI_Rn02_00205248 predicted 851
3 SASI_Rn02_00205249 predicted 1289
4 SASI_Rn02_00205250 predicted 707
5 SASI_Rn02_00205251 predicted 864
6 SASI_Rn02_00205252 predicted 1079
7 SASI_Rn02_00205253 predicted 584
8 SASI_Rn02_00205254 predicted 445
9 SASI_Rn02_00205255 predicted 890
10 SASI_Rn02_00205256 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290309 predicted 1476
2 SASI_Mm02_00290310 predicted 744
3 SASI_Mm01_00031133 predicted 1616
4 SASI_Mm01_00031134 predicted 1396
5 SASI_Mm01_00031136 predicted 1336
6 SASI_Mm01_00031137 predicted 1265
7 SASI_Mm02_00290311 predicted 692
8 SASI_Mm02_00290312 predicted 504
9 SASI_Mm01_00031138 predicted 1465
10 SASI_Mm02_00290313 predicted 595
11 SASI_Mm01_00031135 predicted 731
12 SASI_Mm01_00031139 predicted 952
13 SASI_Mm01_00031140 predicted 369
14 SASI_Mm01_00031141 predicted 1107
15 SASI_Mm01_00031142 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300355 predicted 1545
2 SASI_Mm02_00300356 predicted 743
3 SASI_Mm02_00300357 predicted 1682
4 SASI_Mm02_00300358 predicted 1462
5 SASI_Mm02_00300359 predicted 1406
6 SASI_Mm02_00300360 predicted 1330
7 SASI_Mm02_00300361 predicted 689
8 SASI_Mm02_00300362 predicted 501
9 SASI_Mm02_00300363 predicted 1539
10 SASI_Mm02_00300364 predicted 594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153013
NADK2 MISSION shRNA Bacterial Glycerol Stock
NAD kinase 2, mitochondrial
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153013.3-1467s21c1
Sequence:CCGGGAACTGAACACATATCATTTGCTCGAGCAAATGATATGTGTTCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153013.3-415s21c1
Sequence:CCGGGAGGCAGAGAATCAGGTTATACTCGAGTATAACCTGATTCTCTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-473s1c1
Sequence:CCGGGCTAAGCTTGAATCAGCACAACTCGAGTTGTGCTGATTCAAGCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153013.2-1360s1c1
Sequence:CCGGGCAGGCTTAAATAAAGGACTACTCGAGTAGTCCTTTATTTAAGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-563s1c1
Sequence:CCGGGAGAGCACTAAATGAAGTCTTCTCGAGAAGACTTCATTTAGTGCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-874s1c1
Sequence:CCGGGTATTCGAGAACCAATAGCAACTCGAGTTGCTATTGGTTCTCGAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153013.3-317s21c1
Sequence:CCGGGAACGGTCTGAGGGTCATTTACTCGAGTAAATGACCCTCAGACCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-474s1c1
Sequence:CCGGCTAAGCTTGAATCAGCACAATCTCGAGATTGTGCTGATTCAAGCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153013.3-923s21c1
Sequence:CCGGAGCAGTCGTCAGCGTTGTTTCCTCGAGGAAACAACGCTGACGACTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153013
NADK2 MISSION shRNA shRNA Plasmid DNA
NAD kinase 2, mitochondrial
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153013.3-1467s21c1
Sequence:CCGGGAACTGAACACATATCATTTGCTCGAGCAAATGATATGTGTTCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153013.3-415s21c1
Sequence:CCGGGAGGCAGAGAATCAGGTTATACTCGAGTATAACCTGATTCTCTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-473s1c1
Sequence:CCGGGCTAAGCTTGAATCAGCACAACTCGAGTTGTGCTGATTCAAGCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153013.2-1360s1c1
Sequence:CCGGGCAGGCTTAAATAAAGGACTACTCGAGTAGTCCTTTATTTAAGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-563s1c1
Sequence:CCGGGAGAGCACTAAATGAAGTCTTCTCGAGAAGACTTCATTTAGTGCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-874s1c1
Sequence:CCGGGTATTCGAGAACCAATAGCAACTCGAGTTGCTATTGGTTCTCGAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153013.3-317s21c1
Sequence:CCGGGAACGGTCTGAGGGTCATTTACTCGAGTAAATGACCCTCAGACCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-474s1c1
Sequence:CCGGCTAAGCTTGAATCAGCACAATCTCGAGATTGTGCTGATTCAAGCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153013.3-923s21c1
Sequence:CCGGAGCAGTCGTCAGCGTTGTTTCCTCGAGGAAACAACGCTGACGACTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153013
NADK2 MISSION shRNA Lentiviral Transduction Particles
NAD kinase 2, mitochondrial
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432997    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153013.3-1467s21c1
Sequence:CCGGGAACTGAACACATATCATTTGCTCGAGCAAATGATATGTGTTCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153013.3-415s21c1
Sequence:CCGGGAGGCAGAGAATCAGGTTATACTCGAGTATAACCTGATTCTCTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-473s1c1
Sequence:CCGGGCTAAGCTTGAATCAGCACAACTCGAGTTGTGCTGATTCAAGCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128285    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153013.2-1360s1c1
Sequence:CCGGGCAGGCTTAAATAAAGGACTACTCGAGTAGTCCTTTATTTAAGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-563s1c1
Sequence:CCGGGAGAGCACTAAATGAAGTCTTCTCGAGAAGACTTCATTTAGTGCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-874s1c1
Sequence:CCGGGTATTCGAGAACCAATAGCAACTCGAGTTGCTATTGGTTCTCGAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153013.3-317s21c1
Sequence:CCGGGAACGGTCTGAGGGTCATTTACTCGAGTAAATGACCCTCAGACCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153013.2-474s1c1
Sequence:CCGGCTAAGCTTGAATCAGCACAATCTCGAGATTGTGCTGATTCAAGCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153013.3-923s21c1
Sequence:CCGGAGCAGTCGTCAGCGTTGTTTCCTCGAGGAAACAACGCTGACGACTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085410
VALIDATED
NADK2 MISSION shRNA Bacterial Glycerol Stock
NAD kinase 2, mitochondrial
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000360714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085410.1-536s21c1
Sequence:CCGGACTACTTGAGCGACATCATATCTCGAGATATGATGTCGCTCAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085410.1-1853s21c1
Sequence:CCGGCTCTTTAGAGGCAGGTTAAATCTCGAGATTTAACCTGCCTCTAAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085410.1-1771s21c1
Sequence:CCGGTTCACCGTGAGACGGACTAAACTCGAGTTTAGTCCGTCTCACGGTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085410
VALIDATED
NADK2 MISSION shRNA shRNA Plasmid DNA
NAD kinase 2, mitochondrial
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000360714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085410.1-536s21c1
Sequence:CCGGACTACTTGAGCGACATCATATCTCGAGATATGATGTCGCTCAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085410.1-1853s21c1
Sequence:CCGGCTCTTTAGAGGCAGGTTAAATCTCGAGATTTAACCTGCCTCTAAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085410.1-1771s21c1
Sequence:CCGGTTCACCGTGAGACGGACTAAACTCGAGTTTAGTCCGTCTCACGGTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085410
VALIDATED
NADK2 MISSION shRNA Lentiviral Transduction Particles
NAD kinase 2, mitochondrial
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000360714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085410.1-536s21c1
Sequence:CCGGACTACTTGAGCGACATCATATCTCGAGATATGATGTCGCTCAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085410.1-1853s21c1
Sequence:CCGGCTCTTTAGAGGCAGGTTAAATCTCGAGATTTAACCTGCCTCTAAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001085410.1-1771s21c1
Sequence:CCGGTTCACCGTGAGACGGACTAAACTCGAGTTTAGTCCGTCTCACGGTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_127934
VALIDATED
NADK2 MISSION shRNA Bacterial Glycerol Stock
NAD kinase 2, mitochondrial
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127934.4-952s1c1
Sequence:CCGGGCCGAGCCTTTAACATCGAAACTCGAGTTTCGATGTTAAAGGCTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127934.4-1290s1c1
Sequence:CCGGCGACAAGGAAATCTGACTCTTCTCGAGAAGAGTCAGATTTCCTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127934.4-1083s1c1
Sequence:CCGGGCTGTAGCAGTGGACAATTTACTCGAGTAAATTGTCCACTGCTACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127934.4-1255s1c1
Sequence:CCGGCGCAGGCTGTTGAAGATGTTTCTCGAGAAACATCTTCAACAGCCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127934.4-546s1c1
Sequence:CCGGCGACATCATATTCACACCAAACTCGAGTTTGGTGTGAATATGATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_127934
VALIDATED
NADK2 MISSION shRNA shRNA Plasmid DNA
NAD kinase 2, mitochondrial
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127934.4-952s1c1
Sequence:CCGGGCCGAGCCTTTAACATCGAAACTCGAGTTTCGATGTTAAAGGCTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127934.4-1290s1c1
Sequence:CCGGCGACAAGGAAATCTGACTCTTCTCGAGAAGAGTCAGATTTCCTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127934.4-1083s1c1
Sequence:CCGGGCTGTAGCAGTGGACAATTTACTCGAGTAAATTGTCCACTGCTACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127934.4-1255s1c1
Sequence:CCGGCGCAGGCTGTTGAAGATGTTTCTCGAGAAACATCTTCAACAGCCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127934.4-546s1c1
Sequence:CCGGCGACATCATATTCACACCAAACTCGAGTTTGGTGTGAATATGATGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_127934
VALIDATED
NADK2 MISSION shRNA Lentiviral Transduction Particles
NAD kinase 2, mitochondrial
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127934.4-952s1c1
Sequence:CCGGGCCGAGCCTTTAACATCGAAACTCGAGTTTCGATGTTAAAGGCTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127934.4-1290s1c1
Sequence:CCGGCGACAAGGAAATCTGACTCTTCTCGAGAAGAGTCAGATTTCCTTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127934.4-1083s1c1
Sequence:CCGGGCTGTAGCAGTGGACAATTTACTCGAGTAAATTGTCCACTGCTACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_127934.4-1255s1c1
Sequence:CCGGCGCAGGCTGTTGAAGATGTTTCTCGAGAAACATCTTCAACAGCCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_127934.4-546s1c1
Sequence:CCGGCGACATCATATTCACACCAAACTCGAGTTTGGTGTGAATATGATGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)