EMAIL THIS PAGE TO A FRIEND

NADK

NAD kinase

67 Gene Product Result for
Synonyms: dJ283E3.1
Gene ID:
Human(65220) Summary: NADK catalyzes the transfer of a phosphate group from ATP to NAD to generate NADP, which in its reduced form acts as an electron donor for biosynthetic reactions (Lerner et al., 2001 [PubMed 11594753]
Mouse(192185) NAD kinase
Rat(100125370) NAD kinase
chicken(419403) NAD kinase
cow(513419) NAD kinase
dog(489589) NAD kinase
sheep(101104592) NAD kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023018 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023018 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023018 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023018 siRNAs that have been validated in the lab human pricing
NM_001109678 Rosetta Predictions rat pricing
NM_138671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023018 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130701 validated 1865
1 SASI_Hs01_00130702 validated 1905
2 SASI_Hs02_00356286 predicted 536
3 SASI_Hs01_00130703 predicted 1836
4 SASI_Hs01_00130704 predicted 1863
5 SASI_Hs01_00130705 predicted 2027
6 SASI_Hs01_00130707 predicted 705
7 SASI_Hs01_00130708 predicted 928
8 SASI_Hs01_00130710 predicted 781
9 SASI_Hs02_00356287 predicted 392
10 SASI_Hs01_00130706 predicted 1044
11 SASI_Hs01_00130709 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250642 predicted 1103
2 SASI_Rn02_00250643 predicted 668
3 SASI_Rn02_00250644 predicted 1866
4 SASI_Rn02_00250645 predicted 1420
5 SASI_Rn02_00250646 predicted 1406
6 SASI_Rn02_00250647 predicted 615
7 SASI_Rn02_00250648 predicted 1308
8 SASI_Rn02_00250649 predicted 1336
9 SASI_Rn02_00250650 predicted 1430
10 SASI_Rn02_00250651 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054526 predicted 282
2 SASI_Mm01_00054527 predicted 894
3 SASI_Mm01_00054529 predicted 1082
4 SASI_Mm01_00054530 predicted 905
5 SASI_Mm02_00339740 predicted 436
6 SASI_Mm01_00054531 predicted 641
7 SASI_Mm01_00054532 predicted 373
8 SASI_Mm01_00054533 predicted 611
9 SASI_Mm01_00054534 predicted 729
10 SASI_Mm01_00054535 predicted 422
11 SASI_Mm01_00054528 predicted 824
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023018
VALIDATED
NADK MISSION shRNA Bacterial Glycerol Stock
NAD kinase
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1821s1c1
Sequence:CCGGGCATCAGCATCACTACCTCATCTCGAGATGAGGTAGTGATGCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_023018.3-1497s1c1
Sequence:CCGGGCATTGGAACGTCCGGAAGAACTCGAGTTCTTCCGGACGTTCCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1030s1c1
Sequence:CCGGCCAGGAGAACATGATCGTGTACTCGAGTACACGATCATGTTCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-289s1c1
Sequence:CCGGCGATGAGACCTGGAGTTACAACTCGAGTTGTAACTCCAGGTCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1292s1c1
Sequence:CCGGGAGAACTTTCAGTCCCAAGTTCTCGAGAACTTGGGACTGAAAGTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1132s1c1
Sequence:CCGGTCGAGAAGATTATGATGACATCTCGAGATGTCATCATAATCTTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.3-252s1c1
Sequence:CCGGGAATAAGGAATTGAGTCCAGACTCGAGTCTGGACTCAATTCCTTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-863s21c1
Sequence:GTACCGGCATTCAGCTTTGAGAACTTTCCTCGAGGAAAGTTCTCAAAGCTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023018.3-2218s21c1
Sequence:CCGGTGCTCCCAGGAAGGTAGTTTACTCGAGTAAACTACCTTCCTGGGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023018.3-1869s1c1
Sequence:CCGGCGCAAATCAGTCGGTTGAAATCTCGAGATTTCAACCGACTGATTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.3-727s1c1
Sequence:CCGGGATGACATTTCCAATCAGATACTCGAGTATCTGATTGGAAATGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023018.3-2455s1c1
Sequence:CCGGGCTAGTGATCGTGATCCCTTTCTCGAGAAAGGGATCACGATCACTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.3-1461s1c1
Sequence:CCGGCGTGAGCGACTGGTTTGAGAGCTCGAGCTCTCAAACCAGTCGCTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-1055s21c1
Sequence:CCGGTGCAGTACCAGGTCCTGAATGCTCGAGCATTCAGGACCTGGTACTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-707s21c1
Sequence:CCGGGTACCTTTCGAGAAGATTATGCTCGAGCATAATCTTCTCGAAAGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-614s21c1
Sequence:CCGGAGGAGAACATGATCGTGTATGCTCGAGCATACACGATCATGTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023018
VALIDATED
NADK MISSION shRNA shRNA Plasmid DNA
NAD kinase
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1821s1c1
Sequence:CCGGGCATCAGCATCACTACCTCATCTCGAGATGAGGTAGTGATGCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_023018.3-1497s1c1
Sequence:CCGGGCATTGGAACGTCCGGAAGAACTCGAGTTCTTCCGGACGTTCCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1030s1c1
Sequence:CCGGCCAGGAGAACATGATCGTGTACTCGAGTACACGATCATGTTCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-289s1c1
Sequence:CCGGCGATGAGACCTGGAGTTACAACTCGAGTTGTAACTCCAGGTCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1292s1c1
Sequence:CCGGGAGAACTTTCAGTCCCAAGTTCTCGAGAACTTGGGACTGAAAGTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1132s1c1
Sequence:CCGGTCGAGAAGATTATGATGACATCTCGAGATGTCATCATAATCTTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.3-252s1c1
Sequence:CCGGGAATAAGGAATTGAGTCCAGACTCGAGTCTGGACTCAATTCCTTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-863s21c1
Sequence:GTACCGGCATTCAGCTTTGAGAACTTTCCTCGAGGAAAGTTCTCAAAGCTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023018.3-2218s21c1
Sequence:CCGGTGCTCCCAGGAAGGTAGTTTACTCGAGTAAACTACCTTCCTGGGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023018.3-1869s1c1
Sequence:CCGGCGCAAATCAGTCGGTTGAAATCTCGAGATTTCAACCGACTGATTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.3-727s1c1
Sequence:CCGGGATGACATTTCCAATCAGATACTCGAGTATCTGATTGGAAATGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023018.3-2455s1c1
Sequence:CCGGGCTAGTGATCGTGATCCCTTTCTCGAGAAAGGGATCACGATCACTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.3-1461s1c1
Sequence:CCGGCGTGAGCGACTGGTTTGAGAGCTCGAGCTCTCAAACCAGTCGCTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-1055s21c1
Sequence:CCGGTGCAGTACCAGGTCCTGAATGCTCGAGCATTCAGGACCTGGTACTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-707s21c1
Sequence:CCGGGTACCTTTCGAGAAGATTATGCTCGAGCATAATCTTCTCGAAAGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-614s21c1
Sequence:CCGGAGGAGAACATGATCGTGTATGCTCGAGCATACACGATCATGTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023018
VALIDATED
NADK MISSION shRNA Lentiviral Transduction Particles
NAD kinase
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1821s1c1
Sequence:CCGGGCATCAGCATCACTACCTCATCTCGAGATGAGGTAGTGATGCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_023018.3-1497s1c1
Sequence:CCGGGCATTGGAACGTCCGGAAGAACTCGAGTTCTTCCGGACGTTCCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1030s1c1
Sequence:CCGGCCAGGAGAACATGATCGTGTACTCGAGTACACGATCATGTTCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-289s1c1
Sequence:CCGGCGATGAGACCTGGAGTTACAACTCGAGTTGTAACTCCAGGTCTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1292s1c1
Sequence:CCGGGAGAACTTTCAGTCCCAAGTTCTCGAGAACTTGGGACTGAAAGTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.2-1132s1c1
Sequence:CCGGTCGAGAAGATTATGATGACATCTCGAGATGTCATCATAATCTTCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.3-252s1c1
Sequence:CCGGGAATAAGGAATTGAGTCCAGACTCGAGTCTGGACTCAATTCCTTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-863s21c1
Sequence:GTACCGGCATTCAGCTTTGAGAACTTTCCTCGAGGAAAGTTCTCAAAGCTGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023018.3-2218s21c1
Sequence:CCGGTGCTCCCAGGAAGGTAGTTTACTCGAGTAAACTACCTTCCTGGGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023018.3-1869s1c1
Sequence:CCGGCGCAAATCAGTCGGTTGAAATCTCGAGATTTCAACCGACTGATTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.3-727s1c1
Sequence:CCGGGATGACATTTCCAATCAGATACTCGAGTATCTGATTGGAAATGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023018.3-2455s1c1
Sequence:CCGGGCTAGTGATCGTGATCCCTTTCTCGAGAAAGGGATCACGATCACTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023018.3-1461s1c1
Sequence:CCGGCGTGAGCGACTGGTTTGAGAGCTCGAGCTCTCAAACCAGTCGCTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-1055s21c1
Sequence:CCGGTGCAGTACCAGGTCCTGAATGCTCGAGCATTCAGGACCTGGTACTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-707s21c1
Sequence:CCGGGTACCTTTCGAGAAGATTATGCTCGAGCATAATCTTCTCGAAAGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023018.3-614s21c1
Sequence:CCGGAGGAGAACATGATCGTGTATGCTCGAGCATACACGATCATGTTCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138671
VALIDATED
NADK MISSION shRNA Bacterial Glycerol Stock
NAD kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-895s1c1
Sequence:CCGGGCTATGCAATACCAGGTCTTACTCGAGTAAGACCTGGTATTGCATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-171s1c1
Sequence:CCGGCTGGAGCTACAATCACCCTATCTCGAGATAGGGTGATTGTAGCTCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-517s1c1
Sequence:CCGGCCTGCTATAGTGAGTGATGAACTCGAGTTCATCACTCACTATAGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-1215s1c1
Sequence:CCGGTGGACGGAAGAGACAGGAAATCTCGAGATTTCCTGTCTCTTCCGTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-895s21c1
Sequence:CCGGGCTATGCAATACCAGGTCTTACTCGAGTAAGACCTGGTATTGCATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-1215s21c1
Sequence:CCGGTGGACGGAAGAGACAGGAAATCTCGAGATTTCCTGTCTCTTCCGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-517s21c1
Sequence:CCGGCCTGCTATAGTGAGTGATGAACTCGAGTTCATCACTCACTATAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-171s21c1
Sequence:CCGGCTGGAGCTACAATCACCCTATCTCGAGATAGGGTGATTGTAGCTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138671
VALIDATED
NADK MISSION shRNA shRNA Plasmid DNA
NAD kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-895s1c1
Sequence:CCGGGCTATGCAATACCAGGTCTTACTCGAGTAAGACCTGGTATTGCATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-171s1c1
Sequence:CCGGCTGGAGCTACAATCACCCTATCTCGAGATAGGGTGATTGTAGCTCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-517s1c1
Sequence:CCGGCCTGCTATAGTGAGTGATGAACTCGAGTTCATCACTCACTATAGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-1215s1c1
Sequence:CCGGTGGACGGAAGAGACAGGAAATCTCGAGATTTCCTGTCTCTTCCGTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-895s21c1
Sequence:CCGGGCTATGCAATACCAGGTCTTACTCGAGTAAGACCTGGTATTGCATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-1215s21c1
Sequence:CCGGTGGACGGAAGAGACAGGAAATCTCGAGATTTCCTGTCTCTTCCGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-517s21c1
Sequence:CCGGCCTGCTATAGTGAGTGATGAACTCGAGTTCATCACTCACTATAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-171s21c1
Sequence:CCGGCTGGAGCTACAATCACCCTATCTCGAGATAGGGTGATTGTAGCTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138671
VALIDATED
NADK MISSION shRNA Lentiviral Transduction Particles
NAD kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-895s1c1
Sequence:CCGGGCTATGCAATACCAGGTCTTACTCGAGTAAGACCTGGTATTGCATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-171s1c1
Sequence:CCGGCTGGAGCTACAATCACCCTATCTCGAGATAGGGTGATTGTAGCTCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-517s1c1
Sequence:CCGGCCTGCTATAGTGAGTGATGAACTCGAGTTCATCACTCACTATAGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138671.1-1215s1c1
Sequence:CCGGTGGACGGAAGAGACAGGAAATCTCGAGATTTCCTGTCTCTTCCGTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-895s21c1
Sequence:CCGGGCTATGCAATACCAGGTCTTACTCGAGTAAGACCTGGTATTGCATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-1215s21c1
Sequence:CCGGTGGACGGAAGAGACAGGAAATCTCGAGATTTCCTGTCTCTTCCGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-517s21c1
Sequence:CCGGCCTGCTATAGTGAGTGATGAACTCGAGTTCATCACTCACTATAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138671.1-171s21c1
Sequence:CCGGCTGGAGCTACAATCACCCTATCTCGAGATAGGGTGATTGTAGCTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)