EMAIL THIS PAGE TO A FRIEND

NADSYN1

NAD synthetase 1

67 Gene Product Result for
UniProtKB ID: Q6IA69, Q86SN2, Q9HA25, Q9NVM8
Gene ID:
Human(55191) Summary: Nicotinamide adenine dinucleotide (NAD) is a coenzyme in metabolic redox reactions, a precursor for several cell signaling molecules, and a substrate for protein posttranslational modifications. NAD synthetase (EC 6.3.5.1) catalyzes the final step in the biosynthesis of NAD from nicotinic acid adenine dinucleotide (NaAD).[supplied by OMIM, Apr 2004]
Mouse(78914) NAD synthetase 1
Rat(353255) NAD synthetase 1
Zebrafish(798974) NAD synthetase 1
dog(483674) NAD synthetase 1
cow(513400) NAD synthetase 1
domestic cat(101091654) NAD synthetase 1
chicken(422983) NAD synthetase 1
sheep(101102021) NAD synthetase 1
naked mole-rat(101702422) NAD synthetase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030221 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030221 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030221 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018161 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018161 Rosetta Predictions human pricing
NM_181480 Rosetta Predictions rat pricing
NM_030221 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192184 predicted 796
2 SASI_Hs01_00192185 predicted 405
3 SASI_Hs01_00192186 predicted 781
4 SASI_Hs01_00192187 predicted 2126
5 SASI_Hs01_00192188 predicted 426
6 SASI_Hs01_00192189 predicted 259
7 SASI_Hs01_00192190 predicted 2125
8 SASI_Hs01_00192191 predicted 630
9 SASI_Hs01_00192192 predicted 409
10 SASI_Hs01_00192193 predicted 2117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071799 predicted 1036
2 SASI_Rn01_00071800 predicted 666
3 SASI_Rn01_00071801 predicted 907
4 SASI_Rn01_00071802 predicted 494
5 SASI_Rn01_00071803 predicted 278
6 SASI_Rn01_00071804 predicted 660
7 SASI_Rn01_00071805 predicted 1445
8 SASI_Rn01_00071806 predicted 1921
9 SASI_Rn01_00071807 predicted 1300
10 SASI_Rn01_00071808 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030221 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101708 predicted 1000
2 SASI_Mm02_00336652 predicted 1954
3 SASI_Mm01_00101709 predicted 2336
4 SASI_Mm01_00101711 predicted 254
5 SASI_Mm01_00101713 predicted 1026
6 SASI_Mm01_00101714 predicted 377
7 SASI_Mm02_00336653 predicted 1131
8 SASI_Mm02_00336654 predicted 849
9 SASI_Mm02_00336655 predicted 1544
10 SASI_Mm02_00336656 predicted 1115
11 SASI_Mm01_00101706 predicted 2097
12 SASI_Mm01_00101707 predicted 2029
13 SASI_Mm01_00101710 predicted 2165
14 SASI_Mm01_00101712 predicted 1410
15 SASI_Mm01_00101715 predicted 2091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030221
VALIDATED
NADSYN1 MISSION shRNA Bacterial Glycerol Stock
NAD synthetase 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-2312s1c1
Sequence:CCGGGACCAGATCTTAGTTACCTTTCTCGAGAAAGGTAACTAAGATCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-1332s1c1
Sequence:CCGGGCTGCTCACTACTTGTTACATCTCGAGATGTAACAAGTAGTGAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-364s1c1
Sequence:CCGGCCTATAATGCACCGGAATGTTCTCGAGAACATTCCGGTGCATTATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-257s1c1
Sequence:CCGGGTTGGGATCATTATCACGAATCTCGAGATTCGTGATAATGATCCCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030221.1-2117s1c1
Sequence:CCGGCCTTTCTGTATAACACGAGATCTCGAGATCTCGTGTTATACAGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030221.1-2444s21c1
Sequence:CCGGGTCCTACATGCATGCCTGGTACTCGAGTACCAGGCATGCATGTAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-824s21c1
Sequence:CCGGACGATGGCTGTGCCATGATTGCTCGAGCAATCATGGCACAGCCATCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-389s21c1
Sequence:CCGGACAACTGCAGAGTCATCTTTCCTCGAGGAAAGATGACTCTGCAGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030221.1-2415s21c1
Sequence:CCGGTATAGTCTCTTGCTTACATATCTCGAGATATGTAAGCAAGAGACTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-1123s21c1
Sequence:CCGGGACTTCCTTCGACGGAGCAAACTCGAGTTTGCTCCGTCGAAGGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-1545s21c1
Sequence:CCGGGAATGTGCAGGCTCGGATTAGCTCGAGCTAATCCGAGCCTGCACATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030221.1-2336s21c1
Sequence:CCGGGGAAGAGAGATTTATTCTAATCTCGAGATTAGAATAAATCTCTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030221
VALIDATED
NADSYN1 MISSION shRNA shRNA Plasmid DNA
NAD synthetase 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-2312s1c1
Sequence:CCGGGACCAGATCTTAGTTACCTTTCTCGAGAAAGGTAACTAAGATCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-1332s1c1
Sequence:CCGGGCTGCTCACTACTTGTTACATCTCGAGATGTAACAAGTAGTGAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-364s1c1
Sequence:CCGGCCTATAATGCACCGGAATGTTCTCGAGAACATTCCGGTGCATTATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-257s1c1
Sequence:CCGGGTTGGGATCATTATCACGAATCTCGAGATTCGTGATAATGATCCCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030221.1-2117s1c1
Sequence:CCGGCCTTTCTGTATAACACGAGATCTCGAGATCTCGTGTTATACAGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030221.1-2444s21c1
Sequence:CCGGGTCCTACATGCATGCCTGGTACTCGAGTACCAGGCATGCATGTAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-824s21c1
Sequence:CCGGACGATGGCTGTGCCATGATTGCTCGAGCAATCATGGCACAGCCATCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-389s21c1
Sequence:CCGGACAACTGCAGAGTCATCTTTCCTCGAGGAAAGATGACTCTGCAGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030221.1-2415s21c1
Sequence:CCGGTATAGTCTCTTGCTTACATATCTCGAGATATGTAAGCAAGAGACTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-1123s21c1
Sequence:CCGGGACTTCCTTCGACGGAGCAAACTCGAGTTTGCTCCGTCGAAGGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-1545s21c1
Sequence:CCGGGAATGTGCAGGCTCGGATTAGCTCGAGCTAATCCGAGCCTGCACATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030221.1-2336s21c1
Sequence:CCGGGGAAGAGAGATTTATTCTAATCTCGAGATTAGAATAAATCTCTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030221
VALIDATED
NADSYN1 MISSION shRNA Lentiviral Transduction Particles
NAD synthetase 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112435    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-2312s1c1
Sequence:CCGGGACCAGATCTTAGTTACCTTTCTCGAGAAAGGTAACTAAGATCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-1332s1c1
Sequence:CCGGGCTGCTCACTACTTGTTACATCTCGAGATGTAACAAGTAGTGAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-364s1c1
Sequence:CCGGCCTATAATGCACCGGAATGTTCTCGAGAACATTCCGGTGCATTATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030221.1-257s1c1
Sequence:CCGGGTTGGGATCATTATCACGAATCTCGAGATTCGTGATAATGATCCCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030221.1-2117s1c1
Sequence:CCGGCCTTTCTGTATAACACGAGATCTCGAGATCTCGTGTTATACAGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030221.1-2444s21c1
Sequence:CCGGGTCCTACATGCATGCCTGGTACTCGAGTACCAGGCATGCATGTAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-824s21c1
Sequence:CCGGACGATGGCTGTGCCATGATTGCTCGAGCAATCATGGCACAGCCATCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-389s21c1
Sequence:CCGGACAACTGCAGAGTCATCTTTCCTCGAGGAAAGATGACTCTGCAGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030221.1-2415s21c1
Sequence:CCGGTATAGTCTCTTGCTTACATATCTCGAGATATGTAAGCAAGAGACTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-1123s21c1
Sequence:CCGGGACTTCCTTCGACGGAGCAAACTCGAGTTTGCTCCGTCGAAGGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030221.1-1545s21c1
Sequence:CCGGGAATGTGCAGGCTCGGATTAGCTCGAGCTAATCCGAGCCTGCACATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425354    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030221.1-2336s21c1
Sequence:CCGGGGAAGAGAGATTTATTCTAATCTCGAGATTAGAATAAATCTCTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018161
VALIDATED
NADSYN1 MISSION shRNA Bacterial Glycerol Stock
NAD synthetase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018161.4-1446s1c1
Sequence:CCGGCCACCACATCAGTCTCAACATCTCGAGATGTTGAGACTGATGTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-2023s1c1
Sequence:CCGGGCTGACAAAGTGAAGCGGTTTCTCGAGAAACCGCTTCACTTTGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-275s1c1
Sequence:CCGGGCTACGGATGTTGGGATCATTCTCGAGAATGATCCCAACATCCGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-2128s1c1
Sequence:CCGGAGGTTTGATCTGCGACCATTTCTCGAGAAATGGTCGCAGATCAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-387s1c1
Sequence:CCGGGATGCCTGTAATGCACCGAAACTCGAGTTTCGGTGCATTACAGGCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-276s21c1
Sequence:CCGGCTACGGATGTTGGGATCATTACTCGAGTAATGATCCCAACATCCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-760s21c1
Sequence:CCGGAGGGTGGATCTCGTGACTATGCTCGAGCATAGTCACGAGATCCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-2128s21c1
Sequence:CCGGAGGTTTGATCTGCGACCATTTCTCGAGAAATGGTCGCAGATCAAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-872s21c1
Sequence:CCGGCCATGAACGGAAGCGTCTTTGCTCGAGCAAAGACGCTTCCGTTCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-415s21c1
Sequence:CCGGTACAACTGCAGAGTGATATTCCTCGAGGAATATCACTCTGCAGTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018161
VALIDATED
NADSYN1 MISSION shRNA shRNA Plasmid DNA
NAD synthetase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018161.4-1446s1c1
Sequence:CCGGCCACCACATCAGTCTCAACATCTCGAGATGTTGAGACTGATGTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-2023s1c1
Sequence:CCGGGCTGACAAAGTGAAGCGGTTTCTCGAGAAACCGCTTCACTTTGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-275s1c1
Sequence:CCGGGCTACGGATGTTGGGATCATTCTCGAGAATGATCCCAACATCCGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-2128s1c1
Sequence:CCGGAGGTTTGATCTGCGACCATTTCTCGAGAAATGGTCGCAGATCAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-387s1c1
Sequence:CCGGGATGCCTGTAATGCACCGAAACTCGAGTTTCGGTGCATTACAGGCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-276s21c1
Sequence:CCGGCTACGGATGTTGGGATCATTACTCGAGTAATGATCCCAACATCCGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-760s21c1
Sequence:CCGGAGGGTGGATCTCGTGACTATGCTCGAGCATAGTCACGAGATCCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-2128s21c1
Sequence:CCGGAGGTTTGATCTGCGACCATTTCTCGAGAAATGGTCGCAGATCAAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-872s21c1
Sequence:CCGGCCATGAACGGAAGCGTCTTTGCTCGAGCAAAGACGCTTCCGTTCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-415s21c1
Sequence:CCGGTACAACTGCAGAGTGATATTCCTCGAGGAATATCACTCTGCAGTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018161
VALIDATED
NADSYN1 MISSION shRNA Lentiviral Transduction Particles
NAD synthetase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_018161.4-1446s1c1
Sequence:CCGGCCACCACATCAGTCTCAACATCTCGAGATGTTGAGACTGATGTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-2023s1c1
Sequence:CCGGGCTGACAAAGTGAAGCGGTTTCTCGAGAAACCGCTTCACTTTGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-275s1c1
Sequence:CCGGGCTACGGATGTTGGGATCATTCTCGAGAATGATCCCAACATCCGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-2128s1c1
Sequence:CCGGAGGTTTGATCTGCGACCATTTCTCGAGAAATGGTCGCAGATCAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018161.4-387s1c1
Sequence:CCGGGATGCCTGTAATGCACCGAAACTCGAGTTTCGGTGCATTACAGGCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-276s21c1
Sequence:CCGGCTACGGATGTTGGGATCATTACTCGAGTAATGATCCCAACATCCGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-760s21c1
Sequence:CCGGAGGGTGGATCTCGTGACTATGCTCGAGCATAGTCACGAGATCCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-2128s21c1
Sequence:CCGGAGGTTTGATCTGCGACCATTTCTCGAGAAATGGTCGCAGATCAAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-872s21c1
Sequence:CCGGCCATGAACGGAAGCGTCTTTGCTCGAGCAAAGACGCTTCCGTTCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_018161.4-415s21c1
Sequence:CCGGTACAACTGCAGAGTGATATTCCTCGAGGAATATCACTCTGCAGTTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)