EMAIL THIS PAGE TO A FRIEND

NAE1

NEDD8 activating enzyme E1 subunit 1

80 Gene Product Result for
Synonyms: A-116A10.1 APPBP1 ula-1
UniProtKB ID: Q13564, A6NFN4, B2R700
Gene ID:
Human(8883) Summary: The protein encoded by this gene binds to the beta-amyloid precursor protein. Beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. In addition, the encoded protein can form a heterodimer with UBE1C and bind and activate NEDD8, a ubiquitin-like protein. This protein is required for cell cycle progression through the S/M checkpoint. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(234664) NEDD8 activating enzyme E1 subunit 1
Rat(84019) NEDD8 activating enzyme E1 subunit 1
naked mole-rat(101700870) NEDD8 activating enzyme E1 subunit 1
Domestic Rabbit(100350243) NEDD8 activating enzyme E1 subunit 1
domestic guinea pig(100725751) NEDD8 activating enzyme E1 subunit 1
sheep(101108941) NEDD8 activating enzyme E1 subunit 1
Zebrafish(573336) nedd8 activating enzyme E1 subunit 1
chicken(415792) NEDD8 activating enzyme E1 subunit 1
chicken(776979) NEDD8 activating enzyme E1 subunit 1
cow(614491) NEDD8 activating enzyme E1 subunit 1
Horse(100065540) NEDD8 activating enzyme E1 subunit 1
domestic cat(101086523) NEDD8 activating enzyme E1 subunit 1
dog(610026) NEDD8 activating enzyme E1 subunit 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003905 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018159 Rosetta Predictions human pricing
NM_001018160 Rosetta Predictions human pricing
NM_003905 Rosetta Predictions human pricing
NM_032072 Rosetta Predictions rat pricing
NM_144931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071903 predicted 1017
2 SASI_Hs01_00071904 predicted 1486
3 SASI_Hs01_00071905 predicted 1342
4 SASI_Hs01_00071906 predicted 630
5 SASI_Hs01_00071907 predicted 1638
6 SASI_Hs01_00071908 predicted 803
7 SASI_Hs01_00071909 predicted 758
8 SASI_Hs01_00071910 predicted 645
9 SASI_Hs01_00071911 predicted 1040
10 SASI_Hs01_00071912 predicted 569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163375 predicted 820
2 SASI_Hs01_00163376 predicted 1285
3 SASI_Hs01_00163377 predicted 1148
4 SASI_Hs01_00163378 predicted 436
5 SASI_Hs01_00163379 predicted 1438
6 SASI_Hs01_00163380 predicted 592
7 SASI_Hs01_00163381 predicted 560
8 SASI_Hs01_00163382 predicted 446
9 SASI_Hs01_00163383 predicted 840
10 SASI_Hs02_00307047 predicted 1302
11 SASI_Hs01_00163384 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148475 predicted 918
2 SASI_Hs01_00148476 predicted 1387
3 SASI_Hs01_00148477 predicted 1244
4 SASI_Hs01_00148478 predicted 537
5 SASI_Hs01_00148479 predicted 1536
6 SASI_Hs01_00148480 predicted 703
7 SASI_Hs01_00148481 predicted 661
8 SASI_Hs01_00148482 predicted 551
9 SASI_Hs01_00148483 predicted 945
10 SASI_Hs01_00148484 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032072 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038060 predicted 434
2 SASI_Rn01_00038062 predicted 886
3 SASI_Rn01_00038063 predicted 1210
4 SASI_Rn01_00038064 predicted 1011
5 SASI_Rn02_00265432 predicted 1393
6 SASI_Rn01_00038065 predicted 1114
7 SASI_Rn01_00038066 predicted 511
8 SASI_Rn01_00038067 predicted 678
9 SASI_Rn01_00038068 predicted 903
10 SASI_Rn01_00038069 predicted 500
11 SASI_Rn01_00038061 predicted 1376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128957 predicted 620
2 SASI_Mm01_00128958 predicted 1464
3 SASI_Mm01_00128959 predicted 895
4 SASI_Mm01_00128960 predicted 1027
5 SASI_Mm01_00128961 predicted 1394
6 SASI_Mm01_00128962 predicted 525
7 SASI_Mm01_00128964 predicted 678
8 SASI_Mm01_00128965 predicted 440
9 SASI_Mm01_00128966 predicted 684
10 SASI_Mm02_00340445 predicted 916
11 SASI_Mm01_00128963 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144931
NAE1 MISSION shRNA Bacterial Glycerol Stock
NEDD8 activating enzyme E1 subunit 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-649s21c1
Sequence:CCGGGAGAGAACATCTTCAGTCTTACTCGAGTAAGACTGAAGATGTTCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-587s21c1
Sequence:CCGGATAGAATCTCATCCAGATAATCTCGAGATTATCTGGATGAGATTCTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-664s21c1
Sequence:CCGGGTCTTATGACTTGGACCATATCTCGAGATATGGTCCAAGTCATAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-610s21c1
Sequence:CCCGATTGGAGGATCTACGACTAGACTCGAGTCTAGTCGTAGATCCTCCAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-575s21c1
Sequence:CCGGGAACACCCAGTAATAGAATCTCTCGAGAGATTCTATTACTGGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-154s1c1
Sequence:CCGGGCTTAATAAATGCAACGGCTACTCGAGTAGCCGTTGCATTTATTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-683s1c1
Sequence:CCGGCCATACTCCATGGATTGTGATCTCGAGATCACAATCCATGGAGTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-390s1c1
Sequence:CCGGCTAGACAATGATCCTTCATTTCTCGAGAAATGAAGGATCATTGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-1079s1c1
Sequence:CCGGGCAGAATGTTTACCGAGAGAACTCGAGTTCTCTCGGTAAACATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-1041s1c1
Sequence:CCGGCCTGATATGATTGCAGATTCACTCGAGTGAATCTGCAATCATATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144931
NAE1 MISSION shRNA shRNA Plasmid DNA
NEDD8 activating enzyme E1 subunit 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-649s21c1
Sequence:CCGGGAGAGAACATCTTCAGTCTTACTCGAGTAAGACTGAAGATGTTCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-587s21c1
Sequence:CCGGATAGAATCTCATCCAGATAATCTCGAGATTATCTGGATGAGATTCTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-664s21c1
Sequence:CCGGGTCTTATGACTTGGACCATATCTCGAGATATGGTCCAAGTCATAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-610s21c1
Sequence:CCCGATTGGAGGATCTACGACTAGACTCGAGTCTAGTCGTAGATCCTCCAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-575s21c1
Sequence:CCGGGAACACCCAGTAATAGAATCTCTCGAGAGATTCTATTACTGGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-154s1c1
Sequence:CCGGGCTTAATAAATGCAACGGCTACTCGAGTAGCCGTTGCATTTATTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-683s1c1
Sequence:CCGGCCATACTCCATGGATTGTGATCTCGAGATCACAATCCATGGAGTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-390s1c1
Sequence:CCGGCTAGACAATGATCCTTCATTTCTCGAGAAATGAAGGATCATTGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-1079s1c1
Sequence:CCGGGCAGAATGTTTACCGAGAGAACTCGAGTTCTCTCGGTAAACATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-1041s1c1
Sequence:CCGGCCTGATATGATTGCAGATTCACTCGAGTGAATCTGCAATCATATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144931
NAE1 MISSION shRNA Lentiviral Transduction Particles
NEDD8 activating enzyme E1 subunit 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-649s21c1
Sequence:CCGGGAGAGAACATCTTCAGTCTTACTCGAGTAAGACTGAAGATGTTCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-587s21c1
Sequence:CCGGATAGAATCTCATCCAGATAATCTCGAGATTATCTGGATGAGATTCTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-664s21c1
Sequence:CCGGGTCTTATGACTTGGACCATATCTCGAGATATGGTCCAAGTCATAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-610s21c1
Sequence:CCCGATTGGAGGATCTACGACTAGACTCGAGTCTAGTCGTAGATCCTCCAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144931.3-575s21c1
Sequence:CCGGGAACACCCAGTAATAGAATCTCTCGAGAGATTCTATTACTGGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-154s1c1
Sequence:CCGGGCTTAATAAATGCAACGGCTACTCGAGTAGCCGTTGCATTTATTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-683s1c1
Sequence:CCGGCCATACTCCATGGATTGTGATCTCGAGATCACAATCCATGGAGTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-390s1c1
Sequence:CCGGCTAGACAATGATCCTTCATTTCTCGAGAAATGAAGGATCATTGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-1079s1c1
Sequence:CCGGGCAGAATGTTTACCGAGAGAACTCGAGTTCTCTCGGTAAACATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144931.1-1041s1c1
Sequence:CCGGCCTGATATGATTGCAGATTCACTCGAGTGAATCTGCAATCATATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003905
VALIDATED
NAE1 MISSION shRNA Bacterial Glycerol Stock
NEDD8 activating enzyme E1 subunit 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-1404s21c1
Sequence:CCGGCCAGGAGTATCTAACTATCAACTCGAGTTGATAGTTAGATACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-342s21c1
Sequence:CCGGGCCATGGAATTCTTACAAGAACTCGAGTTCTTGTAAGAATTCCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-921s21c1
Sequence:CCGGCCAAGCAGTATTGAAGATATACTCGAGTATATCTTCAATACTGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-1648s21c1
Sequence:CCGGGCATGTCACAAACTTCAGCAACTCGAGTTGCTGAAGTTTGTGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-911s1c1
Sequence:CCGGCCAAGCAGTATTGAAGATATACTCGAGTATATCTTCAATACTGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-1394s1c1
Sequence:CCGGCCAGGAGTATCTAACTATCAACTCGAGTTGATAGTTAGATACTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-332s1c1
Sequence:CCGGGCCATGGAATTCTTACAAGAACTCGAGTTCTTGTAAGAATTCCATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003905.2-944s1c1
Sequence:CCGGCGCTGCATAAATATCACCAAACTCGAGTTTGGTGATATTTATGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-1638s1c1
Sequence:CCGGGCATGTCACAAACTTCAGCAACTCGAGTTGCTGAAGTTTGTGACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003905
VALIDATED
NAE1 MISSION shRNA shRNA Plasmid DNA
NEDD8 activating enzyme E1 subunit 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-1404s21c1
Sequence:CCGGCCAGGAGTATCTAACTATCAACTCGAGTTGATAGTTAGATACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-342s21c1
Sequence:CCGGGCCATGGAATTCTTACAAGAACTCGAGTTCTTGTAAGAATTCCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-921s21c1
Sequence:CCGGCCAAGCAGTATTGAAGATATACTCGAGTATATCTTCAATACTGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-1648s21c1
Sequence:CCGGGCATGTCACAAACTTCAGCAACTCGAGTTGCTGAAGTTTGTGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-911s1c1
Sequence:CCGGCCAAGCAGTATTGAAGATATACTCGAGTATATCTTCAATACTGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-1394s1c1
Sequence:CCGGCCAGGAGTATCTAACTATCAACTCGAGTTGATAGTTAGATACTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-332s1c1
Sequence:CCGGGCCATGGAATTCTTACAAGAACTCGAGTTCTTGTAAGAATTCCATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003905.2-944s1c1
Sequence:CCGGCGCTGCATAAATATCACCAAACTCGAGTTTGGTGATATTTATGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-1638s1c1
Sequence:CCGGGCATGTCACAAACTTCAGCAACTCGAGTTGCTGAAGTTTGTGACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003905
VALIDATED
NAE1 MISSION shRNA Lentiviral Transduction Particles
NEDD8 activating enzyme E1 subunit 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-1404s21c1
Sequence:CCGGCCAGGAGTATCTAACTATCAACTCGAGTTGATAGTTAGATACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-342s21c1
Sequence:CCGGGCCATGGAATTCTTACAAGAACTCGAGTTCTTGTAAGAATTCCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-921s21c1
Sequence:CCGGCCAAGCAGTATTGAAGATATACTCGAGTATATCTTCAATACTGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003905.3-1648s21c1
Sequence:CCGGGCATGTCACAAACTTCAGCAACTCGAGTTGCTGAAGTTTGTGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-911s1c1
Sequence:CCGGCCAAGCAGTATTGAAGATATACTCGAGTATATCTTCAATACTGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-1394s1c1
Sequence:CCGGCCAGGAGTATCTAACTATCAACTCGAGTTGATAGTTAGATACTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-332s1c1
Sequence:CCGGGCCATGGAATTCTTACAAGAACTCGAGTTCTTGTAAGAATTCCATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003905.2-944s1c1
Sequence:CCGGCGCTGCATAAATATCACCAAACTCGAGTTTGGTGATATTTATGCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003905.2-1638s1c1
Sequence:CCGGGCATGTCACAAACTTCAGCAACTCGAGTTGCTGAAGTTTGTGACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)