EMAIL THIS PAGE TO A FRIEND

NAF1

nuclear assembly factor 1 ribonucleoprotein

69 Gene Product Result for
UniProtKB ID: Q96HR8, D3DP28, E9PAZ2
Gene ID:
Mouse(234344) nuclear assembly factor 1 homolog (S. cerevisiae)
Rat(306387) nuclear assembly factor 1 ribonucleoprotein
Thale Cress(839468) nuclear assembly factor 1
Zebrafish(568328) nuclear assembly factor 1 homolog (S. cerevisiae)
cow(514182) nuclear assembly factor 1 homolog (S. cerevisiae)
Horse(100068623) nuclear assembly factor 1 homolog (S. cerevisiae)
domestic cat(101100126) nuclear assembly factor 1 homolog (S. cerevisiae)
dog(475486) nuclear assembly factor 1 homolog (S. cerevisiae)
chicken(769997) nuclear assembly factor 1 homolog (S. cerevisiae)
sheep(101107601) nuclear assembly factor 1 homolog (S. cerevisiae)
domestic guinea pig(100723505) nuclear assembly factor 1 ribonucleoprotein
naked mole-rat(101696610) nuclear assembly factor 1 ribonucleoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001163564 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163564 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163564 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138386 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138386 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138386 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138386 Rosetta Predictions human pricing
NM_001024772 Rosetta Predictions rat pricing
XM_134209 Rosetta Predictions mouse pricing
XR_032374 Rosetta Predictions mouse pricing
XR_032626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138386 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202597 predicted 1024
2 SASI_Hs01_00202598 predicted 899
3 SASI_Hs01_00202599 predicted 1075
4 SASI_Hs01_00202600 predicted 1014
5 SASI_Hs01_00202602 predicted 943
6 SASI_Hs01_00202603 predicted 968
7 SASI_Hs01_00202604 predicted 911
8 SASI_Hs02_00363525 predicted 1020
9 SASI_Hs01_00202605 predicted 914
10 SASI_Hs01_00202606 predicted 846
11 SASI_Hs01_00202601 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202661 predicted 1048
2 SASI_Rn01_00035676 predicted 679
3 SASI_Rn01_00035677 predicted 730
4 SASI_Rn01_00035679 predicted 561
5 SASI_Rn01_00035680 predicted 532
6 SASI_Rn01_00035681 predicted 855
7 SASI_Rn01_00035682 predicted 801
8 SASI_Rn01_00035683 predicted 631
9 SASI_Rn01_00035684 predicted 680
10 SASI_Rn02_00202662 predicted 805
11 SASI_Rn01_00035675 predicted 813
12 SASI_Rn01_00035678 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_134209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209649 predicted 1076
2 SASI_Mm01_00209650 predicted 2160
3 SASI_Mm01_00209651 predicted 2236
4 SASI_Mm01_00209652 predicted 1032
5 SASI_Mm01_00209653 predicted 2157
6 SASI_Mm01_00209654 predicted 1045
7 SASI_Mm01_00209655 predicted 2222
8 SASI_Mm01_00209656 predicted 1062
9 SASI_Mm01_00209657 predicted 1122
10 SASI_Mm01_00209658 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_032374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00464747 predicted 311
2 SASI_Mm02_00464748 predicted 2991
3 SASI_Mm02_00464749 predicted 3110
4 SASI_Mm02_00464750 predicted 3069
5 SASI_Mm02_00464751 predicted 377
6 SASI_Mm02_00464752 predicted 3262
7 SASI_Mm02_00464753 predicted 3274
8 SASI_Mm02_00464754 predicted 3053
9 SASI_Mm02_00464755 predicted 306
10 SASI_Mm02_00464756 predicted 3308
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_032626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00466329 predicted 2020
2 SASI_Mm02_00466330 predicted 2308
3 SASI_Mm02_00466331 predicted 2028
4 SASI_Mm02_00466332 predicted 2096
5 SASI_Mm02_00466333 predicted 2293
6 SASI_Mm02_00466334 predicted 2506
7 SASI_Mm02_00466335 predicted 2090
8 SASI_Mm02_00466336 predicted 2342
9 SASI_Mm02_00466337 predicted 2375
10 SASI_Mm02_00466338 predicted 1979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163564
NAF1 MISSION shRNA Bacterial Glycerol Stock
nuclear assembly factor 1 ribonucleoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1497s21c1
Sequence:CCGGTGGTGAAGTGCATGAGAATTGCTCGAGCAATTCTCATGCACTTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1508s21c1
Sequence:CCGGATGAGAATTGGAATGCTTATACTCGAGTATAAGCATTCCAATTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1524s21c1
Sequence:CCGGTTATAGCTCTTCAGAACATTCCTCGAGGAATGTTCTGAAGAGCTATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163564.1-2083s21c1
Sequence:CCGGCTCAGTTGTAAGCTCATATATCTCGAGATATATGAGCTTACAACTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1739s21c1
Sequence:CCGGATATGCATAACTTTCCACTTCCTCGAGGAAGTGGAAAGTTATGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163564
NAF1 MISSION shRNA shRNA Plasmid DNA
nuclear assembly factor 1 ribonucleoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1497s21c1
Sequence:CCGGTGGTGAAGTGCATGAGAATTGCTCGAGCAATTCTCATGCACTTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1508s21c1
Sequence:CCGGATGAGAATTGGAATGCTTATACTCGAGTATAAGCATTCCAATTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1524s21c1
Sequence:CCGGTTATAGCTCTTCAGAACATTCCTCGAGGAATGTTCTGAAGAGCTATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163564.1-2083s21c1
Sequence:CCGGCTCAGTTGTAAGCTCATATATCTCGAGATATATGAGCTTACAACTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1739s21c1
Sequence:CCGGATATGCATAACTTTCCACTTCCTCGAGGAAGTGGAAAGTTATGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163564
NAF1 MISSION shRNA Lentiviral Transduction Particles
nuclear assembly factor 1 ribonucleoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1497s21c1
Sequence:CCGGTGGTGAAGTGCATGAGAATTGCTCGAGCAATTCTCATGCACTTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1508s21c1
Sequence:CCGGATGAGAATTGGAATGCTTATACTCGAGTATAAGCATTCCAATTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1524s21c1
Sequence:CCGGTTATAGCTCTTCAGAACATTCCTCGAGGAATGTTCTGAAGAGCTATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163564.1-2083s21c1
Sequence:CCGGCTCAGTTGTAAGCTCATATATCTCGAGATATATGAGCTTACAACTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163564.1-1739s21c1
Sequence:CCGGATATGCATAACTTTCCACTTCCTCGAGGAAGTGGAAAGTTATGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138386
VALIDATED
NAF1 MISSION shRNA Bacterial Glycerol Stock
nuclear assembly factor 1 ribonucleoprotein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000134443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-1417s1c1
Sequence:CCGGGATTTCCTTCTCAGAGACAAACTCGAGTTTGTCTCTGAGAAGGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-858s1c1
Sequence:CCGGCCAGTTAATGAGGAGACTGTACTCGAGTACAGTCTCCTCATTAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-224s1c1
Sequence:CCGGGCTGGAAACTCTGAAATTCAACTCGAGTTGAATTTCAGAGTTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-903s1c1
Sequence:CCGGGCAGGAAAGATATTCGAGATACTCGAGTATCTCGAATATCTTTCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-845s1c1
Sequence:CCGGGACTAACCTACCTCCAGTTAACTCGAGTTAACTGGAGGTAGGTTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138386.1-616s1c1
Sequence:CCGGCGTCTTCTTCCTCTTGTATATCTCGAGATATACAAGAGGAAGAAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138386.2-1743s21c1
Sequence:CCGGCAAGAGTGATTATGGAGCTAGCTCGAGCTAGCTCCATAATCACTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138386.2-1714s21c1
Sequence:CCGGCATATTATGTGGTAAGGATTTCTCGAGAAATCCTTACCACATAATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138386.2-747s21c1
Sequence:CCGGGTTGAAGAACTCACTATTATTCTCGAGAATAATAGTGAGTTCTTCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138386
VALIDATED
NAF1 MISSION shRNA shRNA Plasmid DNA
nuclear assembly factor 1 ribonucleoprotein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000134443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-1417s1c1
Sequence:CCGGGATTTCCTTCTCAGAGACAAACTCGAGTTTGTCTCTGAGAAGGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-858s1c1
Sequence:CCGGCCAGTTAATGAGGAGACTGTACTCGAGTACAGTCTCCTCATTAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-224s1c1
Sequence:CCGGGCTGGAAACTCTGAAATTCAACTCGAGTTGAATTTCAGAGTTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-903s1c1
Sequence:CCGGGCAGGAAAGATATTCGAGATACTCGAGTATCTCGAATATCTTTCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-845s1c1
Sequence:CCGGGACTAACCTACCTCCAGTTAACTCGAGTTAACTGGAGGTAGGTTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138386.1-616s1c1
Sequence:CCGGCGTCTTCTTCCTCTTGTATATCTCGAGATATACAAGAGGAAGAAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138386.2-1743s21c1
Sequence:CCGGCAAGAGTGATTATGGAGCTAGCTCGAGCTAGCTCCATAATCACTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138386.2-1714s21c1
Sequence:CCGGCATATTATGTGGTAAGGATTTCTCGAGAAATCCTTACCACATAATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138386.2-747s21c1
Sequence:CCGGGTTGAAGAACTCACTATTATTCTCGAGAATAATAGTGAGTTCTTCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138386
VALIDATED
NAF1 MISSION shRNA Lentiviral Transduction Particles
nuclear assembly factor 1 ribonucleoprotein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000134443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-1417s1c1
Sequence:CCGGGATTTCCTTCTCAGAGACAAACTCGAGTTTGTCTCTGAGAAGGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-858s1c1
Sequence:CCGGCCAGTTAATGAGGAGACTGTACTCGAGTACAGTCTCCTCATTAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134380    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-224s1c1
Sequence:CCGGGCTGGAAACTCTGAAATTCAACTCGAGTTGAATTTCAGAGTTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-903s1c1
Sequence:CCGGGCAGGAAAGATATTCGAGATACTCGAGTATCTCGAATATCTTTCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_138386.1-845s1c1
Sequence:CCGGGACTAACCTACCTCCAGTTAACTCGAGTTAACTGGAGGTAGGTTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138386.1-616s1c1
Sequence:CCGGCGTCTTCTTCCTCTTGTATATCTCGAGATATACAAGAGGAAGAAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427405    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138386.2-1743s21c1
Sequence:CCGGCAAGAGTGATTATGGAGCTAGCTCGAGCTAGCTCCATAATCACTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421333    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138386.2-1714s21c1
Sequence:CCGGCATATTATGTGGTAAGGATTTCTCGAGAAATCCTTACCACATAATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138386.2-747s21c1
Sequence:CCGGGTTGAAGAACTCACTATTATTCTCGAGAATAATAGTGAGTTCTTCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)