EMAIL THIS PAGE TO A FRIEND

NAGLU

N-acetylglucosaminidase, alpha

60 Gene Product Result for
Synonyms: MPS-IIIB MPS3B NAG UFHSD
UniProtKB ID: P54802
Gene ID:
Human(4669) Summary: This gene encodes an enzyme that degrades heparan sulfate by hydrolysis of terminal N-acetyl-D-glucosamine residues in N-acetyl-alpha-D-glucosaminides. Defects in this gene are the cause of mucopolysaccharidosis type IIIB (MPS-IIIB), also known as Sanfilippo syndrome B. This disease is characterized by the lysosomal accumulation and urinary excretion of heparan sulfate. [provided by RefSeq, Jul 2008]
Mouse(27419) alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Rat(360630) N-acetylglucosaminidase, alpha
domestic guinea pig(100717917) N-acetylglucosaminidase, alpha
Domestic Rabbit(100344181) N-acetylglucosaminidase, alpha
naked mole-rat(101723414) N-acetylglucosaminidase, alpha
sheep(101102252) N-acetylglucosaminidase, alpha
Zebrafish(560126) N-acetylglucosaminidase, alpha
cow(789125) N-acetylglucosaminidase, alpha
Horse(100066052) N-acetylglucosaminidase, alpha
domestic cat(101091166) N-acetylglucosaminidase, alpha
dog(490965) N-acetylglucosaminidase, alpha
chicken(771195) N-acetylglucosaminidase, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000263 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000263 Rosetta Predictions human pricing
XM_001081442 Rosetta Predictions rat pricing
XM_340905 Rosetta Predictions rat pricing
NM_013792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156030 predicted 1029
2 SASI_Hs01_00156031 predicted 1139
3 SASI_Hs01_00156032 predicted 1143
4 SASI_Hs01_00156033 predicted 2517
5 SASI_Hs01_00156034 predicted 1816
6 SASI_Hs01_00156035 predicted 1688
7 SASI_Hs01_00156036 predicted 1489
8 SASI_Hs01_00156037 predicted 1728
9 SASI_Hs01_00156038 predicted 1677
10 SASI_Hs02_00302209 predicted 1109
11 SASI_Hs01_00156039 predicted 904
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081442 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00371916 predicted 1995
2 SASI_Rn02_00371917 predicted 2098
3 SASI_Rn02_00371918 predicted 1392
4 SASI_Rn02_00371919 predicted 424
5 SASI_Rn02_00371920 predicted 590
6 SASI_Rn02_00371921 predicted 1857
7 SASI_Rn02_00371922 predicted 2115
8 SASI_Rn02_00371923 predicted 2158
9 SASI_Rn02_00371924 predicted 2217
10 SASI_Rn02_00371925 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340905 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00185286 predicted 659
2 SASI_Rn01_00185287 predicted 1856
3 SASI_Rn01_00185288 predicted 1963
4 SASI_Rn01_00185289 predicted 1241
5 SASI_Rn01_00185290 predicted 389
6 SASI_Rn01_00185291 predicted 557
7 SASI_Rn01_00185292 predicted 1723
8 SASI_Rn01_00185293 predicted 1977
9 SASI_Rn01_00185294 predicted 2018
10 SASI_Rn01_00185295 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00034229 predicted 2057
2 SASI_Mm01_00034230 predicted 892
3 SASI_Mm01_00034231 predicted 1350
4 SASI_Mm02_00322746 predicted 464
5 SASI_Mm01_00034232 predicted 2076
6 SASI_Mm01_00034233 predicted 893
7 SASI_Mm01_00034234 predicted 671
8 SASI_Mm01_00034235 predicted 1196
9 SASI_Mm01_00034236 predicted 549
10 SASI_Mm02_00322747 predicted 1577
11 SASI_Mm01_00034237 predicted 2077
12 SASI_Mm01_00034238 predicted 386
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013792
VALIDATED
NAGLU MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosaminidase, alpha
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.2-542s21c1
Sequence:CCGGGCCATCTGGCAAAGGGTATACCTCGAGGTATACCCTTTGCCAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-549s21c1
Sequence:CCGGCCAGTCAGAGATCGATACGTACTCGAGTACGTATCGATCTCTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-1386s21c1
Sequence:CCGGCAAGGACCCTGTACCAGATTTCTCGAGAAATCTGGTACAGGGTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-2248s21c1
Sequence:CCGGGAATAGGTCCTCAAATCCAAACTCGAGTTTGGATTTGAGGACCTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-2242s1c1
Sequence:CCGGCTGCTGGAATAGGTCCTCAAACTCGAGTTTGAGGACCTATTCCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013792.1-2118s1c1
Sequence:CCGGCGTTTACAACAAGAAGAGGTACTCGAGTACCTCTTCTTGTTGTAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-549s1c1
Sequence:CCGGCCAGTCAGAGATCGATACGTACTCGAGTACGTATCGATCTCTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-1579s1c1
Sequence:CCGGGTCTGGTACAACAGATCAGATCTCGAGATCTGATCTGTTGTACCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.2-2097s21c1
Sequence:CCGGCCTTCCAACAGCACGAGTTTGCTCGAGCAAACTCGTGCTGTTGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.2-2276s21c1
Sequence:CCGGCTGGAATAGGTCCTCAAATCCCTCGAGGGATTTGAGGACCTATTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-898s21c1
Sequence:CCGGGAGTTTGGCACAGATCATATCCTCGAGGATATGATCTGTGCCAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-1482s1c1
Sequence:CCGGCCTACTCAGAAGTGTCTACAACTCGAGTTGTAGACACTTCTGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013792
VALIDATED
NAGLU MISSION shRNA shRNA Plasmid DNA
N-acetylglucosaminidase, alpha
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.2-542s21c1
Sequence:CCGGGCCATCTGGCAAAGGGTATACCTCGAGGTATACCCTTTGCCAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-549s21c1
Sequence:CCGGCCAGTCAGAGATCGATACGTACTCGAGTACGTATCGATCTCTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-1386s21c1
Sequence:CCGGCAAGGACCCTGTACCAGATTTCTCGAGAAATCTGGTACAGGGTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-2248s21c1
Sequence:CCGGGAATAGGTCCTCAAATCCAAACTCGAGTTTGGATTTGAGGACCTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-2242s1c1
Sequence:CCGGCTGCTGGAATAGGTCCTCAAACTCGAGTTTGAGGACCTATTCCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013792.1-2118s1c1
Sequence:CCGGCGTTTACAACAAGAAGAGGTACTCGAGTACCTCTTCTTGTTGTAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-549s1c1
Sequence:CCGGCCAGTCAGAGATCGATACGTACTCGAGTACGTATCGATCTCTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-1579s1c1
Sequence:CCGGGTCTGGTACAACAGATCAGATCTCGAGATCTGATCTGTTGTACCAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.2-2097s21c1
Sequence:CCGGCCTTCCAACAGCACGAGTTTGCTCGAGCAAACTCGTGCTGTTGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.2-2276s21c1
Sequence:CCGGCTGGAATAGGTCCTCAAATCCCTCGAGGGATTTGAGGACCTATTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-898s21c1
Sequence:CCGGGAGTTTGGCACAGATCATATCCTCGAGGATATGATCTGTGCCAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000112001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-1482s1c1
Sequence:CCGGCCTACTCAGAAGTGTCTACAACTCGAGTTGTAGACACTTCTGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013792
VALIDATED
NAGLU MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosaminidase, alpha
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.2-542s21c1
Sequence:CCGGGCCATCTGGCAAAGGGTATACCTCGAGGTATACCCTTTGCCAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-549s21c1
Sequence:CCGGCCAGTCAGAGATCGATACGTACTCGAGTACGTATCGATCTCTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-1386s21c1
Sequence:CCGGCAAGGACCCTGTACCAGATTTCTCGAGAAATCTGGTACAGGGTCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319491    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-2248s21c1
Sequence:CCGGGAATAGGTCCTCAAATCCAAACTCGAGTTTGGATTTGAGGACCTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112000    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-2242s1c1
Sequence:CCGGCTGCTGGAATAGGTCCTCAAACTCGAGTTTGAGGACCTATTCCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013792.1-2118s1c1
Sequence:CCGGCGTTTACAACAAGAAGAGGTACTCGAGTACCTCTTCTTGTTGTAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-549s1c1
Sequence:CCGGCCAGTCAGAGATCGATACGTACTCGAGTACGTATCGATCTCTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-1579s1c1
Sequence:CCGGGTCTGGTACAACAGATCAGATCTCGAGATCTGATCTGTTGTACCAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.2-2097s21c1
Sequence:CCGGCCTTCCAACAGCACGAGTTTGCTCGAGCAAACTCGTGCTGTTGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.2-2276s21c1
Sequence:CCGGCTGGAATAGGTCCTCAAATCCCTCGAGGGATTTGAGGACCTATTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013792.1-898s21c1
Sequence:CCGGGAGTTTGGCACAGATCATATCCTCGAGGATATGATCTGTGCCAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000112001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013792.1-1482s1c1
Sequence:CCGGCCTACTCAGAAGTGTCTACAACTCGAGTTGTAGACACTTCTGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000263
VALIDATED
NAGLU MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosaminidase, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-1899s21c1
Sequence:CCGGGGCCGTCCCTACAGATGAATACTCGAGTATTCATCTGTAGGGACGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-2559s21c1
Sequence:CCGGCCGGCTCTTGGTGATAGATTCCTCGAGGAATCTATCACCAAGAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000263.3-2602s21c1
Sequence:CCGGCGCTAATTCCAGGGCAGATTCCTCGAGGAATCTGCCCTGGAATTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000263.2-2411s1c1
Sequence:CCGGCCTTTCCAACAGCACCAGTTTCTCGAGAAACTGGTGCTGTTGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000263.2-1686s1c1
Sequence:CCGGGCCAGAACGAAGTGGTCTATTCTCGAGAATAGACCACTTCGTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-1686s21c1
Sequence:CCGGGCCAGAACGAAGTGGTCTATTCTCGAGAATAGACCACTTCGTTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-746s21c1
Sequence:CCGGTGCACGCAAAGCTACTCTTTCCTCGAGGAAAGAGTAGCTTTGCGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000263.2-2635s1c1
Sequence:CCGGCTGGACAGACATCACAGGATACTCGAGTATCCTGTGATGTCTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000263.2-2058s1c1
Sequence:CCGGGCTTGTACTATGAGGAGGCAACTCGAGTTGCCTCCTCATAGTACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000263.2-899s1c1
Sequence:CCGGGCAGAGATCAATGAGTTCTTTCTCGAGAAAGAACTCATTGATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000263
VALIDATED
NAGLU MISSION shRNA shRNA Plasmid DNA
N-acetylglucosaminidase, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-1899s21c1
Sequence:CCGGGGCCGTCCCTACAGATGAATACTCGAGTATTCATCTGTAGGGACGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-2559s21c1
Sequence:CCGGCCGGCTCTTGGTGATAGATTCCTCGAGGAATCTATCACCAAGAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000263.3-2602s21c1
Sequence:CCGGCGCTAATTCCAGGGCAGATTCCTCGAGGAATCTGCCCTGGAATTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000263.2-2411s1c1
Sequence:CCGGCCTTTCCAACAGCACCAGTTTCTCGAGAAACTGGTGCTGTTGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000263.2-1686s1c1
Sequence:CCGGGCCAGAACGAAGTGGTCTATTCTCGAGAATAGACCACTTCGTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-1686s21c1
Sequence:CCGGGCCAGAACGAAGTGGTCTATTCTCGAGAATAGACCACTTCGTTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-746s21c1
Sequence:CCGGTGCACGCAAAGCTACTCTTTCCTCGAGGAAAGAGTAGCTTTGCGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000263.2-2635s1c1
Sequence:CCGGCTGGACAGACATCACAGGATACTCGAGTATCCTGTGATGTCTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000263.2-2058s1c1
Sequence:CCGGGCTTGTACTATGAGGAGGCAACTCGAGTTGCCTCCTCATAGTACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000263.2-899s1c1
Sequence:CCGGGCAGAGATCAATGAGTTCTTTCTCGAGAAAGAACTCATTGATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000263
VALIDATED
NAGLU MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosaminidase, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-1899s21c1
Sequence:CCGGGGCCGTCCCTACAGATGAATACTCGAGTATTCATCTGTAGGGACGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-2559s21c1
Sequence:CCGGCCGGCTCTTGGTGATAGATTCCTCGAGGAATCTATCACCAAGAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000263.3-2602s21c1
Sequence:CCGGCGCTAATTCCAGGGCAGATTCCTCGAGGAATCTGCCCTGGAATTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000263.2-2411s1c1
Sequence:CCGGCCTTTCCAACAGCACCAGTTTCTCGAGAAACTGGTGCTGTTGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000263.2-1686s1c1
Sequence:CCGGGCCAGAACGAAGTGGTCTATTCTCGAGAATAGACCACTTCGTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-1686s21c1
Sequence:CCGGGCCAGAACGAAGTGGTCTATTCTCGAGAATAGACCACTTCGTTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000263.3-746s21c1
Sequence:CCGGTGCACGCAAAGCTACTCTTTCCTCGAGGAAAGAGTAGCTTTGCGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063718    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000263.2-2635s1c1
Sequence:CCGGCTGGACAGACATCACAGGATACTCGAGTATCCTGTGATGTCTGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000263.2-2058s1c1
Sequence:CCGGGCTTGTACTATGAGGAGGCAACTCGAGTTGCCTCCTCATAGTACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000263.2-899s1c1
Sequence:CCGGGCAGAGATCAATGAGTTCTTTCTCGAGAAAGAACTCATTGATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)