EMAIL THIS PAGE TO A FRIEND

NAGPA

N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase

41 Gene Product Result for
Synonyms: APAA UCE
UniProtKB ID: Q9UK23, B2RAS1, Q96EJ8
Gene ID:
Human(51172) Summary: Hydrolases are transported to lysosomes after binding to mannose 6-phosphate receptors in the trans-Golgi network. This gene encodes the enzyme that catalyzes the second step in the formation of the mannose 6-phosphate recognition marker on lysosomal hydrolases. Commonly known as 'uncovering enzyme' or UCE, this enzyme removes N-acetyl-D-glucosamine (GlcNAc) residues from GlcNAc-alpha-P-mannose moieties and thereby produces the recognition marker. This reaction most likely occurs in the trans-Golgi network. This enzyme functions as a homotetramer of two disulfide-linked homodimers. In addition to having an N-terminal signal peptide, the protein's C-terminus contains multiple signals for trafficking it between lysosomes, the plasma membrane, and trans-Golgi network. [provided by RefSeq, Jul 2008]
Mouse(27426) N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Rat(360476) N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
chicken(416395) N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
dog(490019) N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
domestic cat(101091582) N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
cow(515935) N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
sheep(101104545) N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
naked mole-rat(101704527) N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
domestic guinea pig(100723215) N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016256 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013796 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013796 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013796 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025501 MISSION® esiRNA esiRNA targeting mouse Nagpa (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016256 Rosetta Predictions human pricing
NM_001108265 Rosetta Predictions rat pricing
NM_013796 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070433 predicted 1277
2 SASI_Hs01_00070434 predicted 741
3 SASI_Hs01_00070435 predicted 1894
4 SASI_Hs01_00070436 predicted 1905
5 SASI_Hs01_00070437 predicted 1690
6 SASI_Hs01_00070438 predicted 910
7 SASI_Hs01_00070439 predicted 1176
8 SASI_Hs01_00070440 predicted 923
9 SASI_Hs01_00070441 predicted 583
10 SASI_Hs01_00070442 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236954 predicted 556
2 SASI_Rn02_00236955 predicted 1847
3 SASI_Rn02_00236956 predicted 1597
4 SASI_Rn02_00236957 predicted 1047
5 SASI_Rn02_00236958 predicted 265
6 SASI_Rn02_00236959 predicted 718
7 SASI_Rn02_00236960 predicted 645
8 SASI_Rn02_00236961 predicted 742
9 SASI_Rn02_00236962 predicted 939
10 SASI_Rn02_00236963 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013796 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064708 predicted 603
2 SASI_Mm01_00064709 predicted 1592
3 SASI_Mm01_00064710 predicted 1188
4 SASI_Mm01_00064711 predicted 783
5 SASI_Mm01_00064712 predicted 645
6 SASI_Mm01_00064713 predicted 923
7 SASI_Mm01_00064714 predicted 550
8 SASI_Mm01_00064715 predicted 628
9 SASI_Mm01_00064716 predicted 885
10 SASI_Mm01_00064717 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016256
VALIDATED
NAGPA MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016256.1-1383s1c1
Sequence:CCGGGCTGATCAGCATTGCAGCAAACTCGAGTTTGCTGCAATGCTGATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-122s21c1
Sequence:CCGGACGACTTGCTACTGCCCTATCCTCGAGGATAGGGCAGTAGCAAGTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016256.1-671s1c1
Sequence:CCGGCACAGGAGACAGGTTCCTTTACTCGAGTAAAGGAACCTGTCTCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-888s21c1
Sequence:CCGGCTCTGCCACCTTTGTGCTCAACTCGAGTTGAGCACAAAGGTGGCAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016256.1-612s1c1
Sequence:CCGGGCTGATTCGTAATGGAAGCATCTCGAGATGCTTCCATTACGAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016256.1-1214s1c1
Sequence:CCGGGTTGTAAGTGTGAGCACCATTCTCGAGAATGGTGCTCACACTTACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016256.1-758s1c1
Sequence:CCGGTCTTTCATGCAGACGGCCATACTCGAGTATGGCCGTCTGCATGAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-780s21c1
Sequence:CCGGCTTTCATGCAGACGGCCAAACCTCGAGGTTTGGCCGTCTGCATGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-813s21c1
Sequence:CCGGCATCAACCTGTGGGAAATGGCCTCGAGGCCATTTCCCACAGGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-57s21c1
Sequence:CCGGGCTTGCACTATTCGGCTTCCTCTCGAGAGGAAGCCGAATAGTGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016256.2-1592s21c1
Sequence:CCGGCACGTCGCGAAAGCTTGTTTCCTCGAGGAAACAAGCTTTCGCGACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-730s21c1
Sequence:CCGGATATCAGCCAGGACGGCCATTCTCGAGAATGGCCGTCCTGGCTGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016256
VALIDATED
NAGPA MISSION shRNA shRNA Plasmid DNA
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016256.1-1383s1c1
Sequence:CCGGGCTGATCAGCATTGCAGCAAACTCGAGTTTGCTGCAATGCTGATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-122s21c1
Sequence:CCGGACGACTTGCTACTGCCCTATCCTCGAGGATAGGGCAGTAGCAAGTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016256.1-671s1c1
Sequence:CCGGCACAGGAGACAGGTTCCTTTACTCGAGTAAAGGAACCTGTCTCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-888s21c1
Sequence:CCGGCTCTGCCACCTTTGTGCTCAACTCGAGTTGAGCACAAAGGTGGCAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016256.1-612s1c1
Sequence:CCGGGCTGATTCGTAATGGAAGCATCTCGAGATGCTTCCATTACGAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016256.1-1214s1c1
Sequence:CCGGGTTGTAAGTGTGAGCACCATTCTCGAGAATGGTGCTCACACTTACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016256.1-758s1c1
Sequence:CCGGTCTTTCATGCAGACGGCCATACTCGAGTATGGCCGTCTGCATGAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-780s21c1
Sequence:CCGGCTTTCATGCAGACGGCCAAACCTCGAGGTTTGGCCGTCTGCATGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-813s21c1
Sequence:CCGGCATCAACCTGTGGGAAATGGCCTCGAGGCCATTTCCCACAGGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-57s21c1
Sequence:CCGGGCTTGCACTATTCGGCTTCCTCTCGAGAGGAAGCCGAATAGTGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016256.2-1592s21c1
Sequence:CCGGCACGTCGCGAAAGCTTGTTTCCTCGAGGAAACAAGCTTTCGCGACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-730s21c1
Sequence:CCGGATATCAGCCAGGACGGCCATTCTCGAGAATGGCCGTCCTGGCTGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016256
VALIDATED
NAGPA MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016256.1-1383s1c1
Sequence:CCGGGCTGATCAGCATTGCAGCAAACTCGAGTTTGCTGCAATGCTGATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-122s21c1
Sequence:CCGGACGACTTGCTACTGCCCTATCCTCGAGGATAGGGCAGTAGCAAGTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016256.1-671s1c1
Sequence:CCGGCACAGGAGACAGGTTCCTTTACTCGAGTAAAGGAACCTGTCTCCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-888s21c1
Sequence:CCGGCTCTGCCACCTTTGTGCTCAACTCGAGTTGAGCACAAAGGTGGCAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016256.1-612s1c1
Sequence:CCGGGCTGATTCGTAATGGAAGCATCTCGAGATGCTTCCATTACGAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016256.1-1214s1c1
Sequence:CCGGGTTGTAAGTGTGAGCACCATTCTCGAGAATGGTGCTCACACTTACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016256.1-758s1c1
Sequence:CCGGTCTTTCATGCAGACGGCCATACTCGAGTATGGCCGTCTGCATGAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-780s21c1
Sequence:CCGGCTTTCATGCAGACGGCCAAACCTCGAGGTTTGGCCGTCTGCATGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-813s21c1
Sequence:CCGGCATCAACCTGTGGGAAATGGCCTCGAGGCCATTTCCCACAGGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-57s21c1
Sequence:CCGGGCTTGCACTATTCGGCTTCCTCTCGAGAGGAAGCCGAATAGTGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016256.2-1592s21c1
Sequence:CCGGCACGTCGCGAAAGCTTGTTTCCTCGAGGAAACAAGCTTTCGCGACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016256.2-730s21c1
Sequence:CCGGATATCAGCCAGGACGGCCATTCTCGAGAATGGCCGTCCTGGCTGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013796
VALIDATED
NAGPA MISSION shRNA Bacterial Glycerol Stock
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013796.3-1681s21c1
Sequence:CCGGCACCCTTTGCTGGCCATATTCCTCGAGGAATATGGCCAGCAAAGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-1722s1c1
Sequence:CCGGGCTCATGCCAACCTAGCAATACTCGAGTATTGCTAGGTTGGCATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-857s1c1
Sequence:CCGGCGTCAACAAGATGTCGTCAATCTCGAGATTGACGACATCTTGTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013796.1-785s1c1
Sequence:CCGGCTTATCCTCTTCCATGCTGATCTCGAGATCAGCATGGAAGAGGATAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-652s1c1
Sequence:CCGGCCGCAATGGAAACATCTACATCTCGAGATGTAGATGTTTCCATTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-1389s1c1
Sequence:CCGGCCCTCACCCTGACACTAATTTCTCGAGAAATTAGTGTCAGGGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013796.3-1597s21c1
Sequence:CCGGACGGCATGCTCCAGATAATCTCTCGAGAGATTATCTGGAGCATGCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013796
VALIDATED
NAGPA MISSION shRNA shRNA Plasmid DNA
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013796.3-1681s21c1
Sequence:CCGGCACCCTTTGCTGGCCATATTCCTCGAGGAATATGGCCAGCAAAGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-1722s1c1
Sequence:CCGGGCTCATGCCAACCTAGCAATACTCGAGTATTGCTAGGTTGGCATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-857s1c1
Sequence:CCGGCGTCAACAAGATGTCGTCAATCTCGAGATTGACGACATCTTGTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013796.1-785s1c1
Sequence:CCGGCTTATCCTCTTCCATGCTGATCTCGAGATCAGCATGGAAGAGGATAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-652s1c1
Sequence:CCGGCCGCAATGGAAACATCTACATCTCGAGATGTAGATGTTTCCATTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-1389s1c1
Sequence:CCGGCCCTCACCCTGACACTAATTTCTCGAGAAATTAGTGTCAGGGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013796.3-1597s21c1
Sequence:CCGGACGGCATGCTCCAGATAATCTCTCGAGAGATTATCTGGAGCATGCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013796
VALIDATED
NAGPA MISSION shRNA Lentiviral Transduction Particles
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435145    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013796.3-1681s21c1
Sequence:CCGGCACCCTTTGCTGGCCATATTCCTCGAGGAATATGGCCAGCAAAGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-1722s1c1
Sequence:CCGGGCTCATGCCAACCTAGCAATACTCGAGTATTGCTAGGTTGGCATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-857s1c1
Sequence:CCGGCGTCAACAAGATGTCGTCAATCTCGAGATTGACGACATCTTGTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013796.1-785s1c1
Sequence:CCGGCTTATCCTCTTCCATGCTGATCTCGAGATCAGCATGGAAGAGGATAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-652s1c1
Sequence:CCGGCCGCAATGGAAACATCTACATCTCGAGATGTAGATGTTTCCATTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013796.1-1389s1c1
Sequence:CCGGCCCTCACCCTGACACTAATTTCTCGAGAAATTAGTGTCAGGGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013796.3-1597s21c1
Sequence:CCGGACGGCATGCTCCAGATAATCTCTCGAGAGATTATCTGGAGCATGCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)