EMAIL THIS PAGE TO A FRIEND

NAGS

N-acetylglutamate synthase

73 Gene Product Result for
Synonyms: AGAS ARGA
UniProtKB ID: Q8N159, B2RAZ9, Q8IWR4
Gene ID:
Human(162417) Summary: The N-acetylglutamate synthase gene encodes a mitochondrial enzyme that catalyzes the formation of N-acetylglutamate (NAG) from glutamate and acetyl coenzyme-A. NAG is a cofactor of carbamyl phosphate synthetase I (CPSI), the first enzyme of the urea cycle in mammals. This gene may regulate ureagenesis by altering NAG availability and, thereby, CPSI activity. Deficiencies in N-acetylglutamate synthase have been associated with hyperammonemia. [provided by RefSeq, Jul 2008]
Mouse(217214) N-acetylglutamate synthase
Rat(303563) N-acetylglutamate synthase
dog(490943) N-acetylglutamate synthase
cow(538004) N-acetylglutamate synthase
Horse(100051467) N-acetylglutamate synthase
domestic cat(101097029) N-acetylglutamate synthase
domestic guinea pig(100729618) N-acetylglutamate synthase
naked mole-rat(101696446) N-acetylglutamate synthase
sheep(101112658) N-acetylglutamate synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153006 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153006 Rosetta Predictions human pricing
NM_001107053 Rosetta Predictions rat pricing
XM_220939 Rosetta Predictions rat pricing
NM_145829 Rosetta Predictions mouse pricing
NM_178053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020990 predicted 1441
2 SASI_Hs01_00020991 predicted 1052
3 SASI_Hs01_00020992 predicted 1811
4 SASI_Hs01_00020993 predicted 1514
5 SASI_Hs01_00020994 predicted 391
6 SASI_Hs01_00020995 predicted 456
7 SASI_Hs01_00020996 predicted 592
8 SASI_Hs01_00020997 predicted 1629
9 SASI_Hs01_00020998 predicted 1164
10 SASI_Hs01_00020999 predicted 1806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225026 predicted 956
2 SASI_Rn02_00225027 predicted 1581
3 SASI_Rn02_00225028 predicted 1804
4 SASI_Rn02_00225029 predicted 251
5 SASI_Rn02_00225030 predicted 1884
6 SASI_Rn02_00225031 predicted 1286
7 SASI_Rn02_00225032 predicted 1027
8 SASI_Rn02_00225033 predicted 1367
9 SASI_Rn02_00225034 predicted 1076
10 SASI_Rn02_00225035 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00125553 predicted 1065
2 SASI_Rn01_00125554 predicted 484
3 SASI_Rn01_00125555 predicted 1310
4 SASI_Rn01_00125556 predicted 1043
5 SASI_Rn01_00125557 predicted 1530
6 SASI_Rn01_00125558 predicted 1259
7 SASI_Rn01_00125559 predicted 407
8 SASI_Rn01_00125560 predicted 215
9 SASI_Rn01_00125561 predicted 1240
10 SASI_Rn01_00125562 predicted 1294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059190 predicted 1034
2 SASI_Mm01_00059191 predicted 609
3 SASI_Mm01_00059192 predicted 935
4 SASI_Mm01_00059193 predicted 1017
5 SASI_Mm01_00059194 predicted 1003
6 SASI_Mm02_00341296 predicted 1358
7 SASI_Mm01_00059195 predicted 1174
8 SASI_Mm01_00059196 predicted 1215
9 SASI_Mm01_00059197 predicted 802
10 SASI_Mm01_00059199 predicted 975
11 SASI_Mm01_00059198 predicted 688
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135433 predicted 757
2 SASI_Mm01_00135434 predicted 326
3 SASI_Mm01_00135435 predicted 661
4 SASI_Mm01_00135436 predicted 740
5 SASI_Mm01_00135437 predicted 722
6 SASI_Mm02_00348512 predicted 1073
7 SASI_Mm01_00135438 predicted 891
8 SASI_Mm01_00135439 predicted 929
9 SASI_Mm01_00135440 predicted 521
10 SASI_Mm01_00135442 predicted 692
11 SASI_Mm01_00135441 predicted 405
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178053
NAGS MISSION shRNA Bacterial Glycerol Stock
N-acetylglutamate synthase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178053.4-637s21c1
Sequence:CCGGCGCTGACCTTGACCTTGTTACCTCGAGGTAACAAGGTCAAGGTCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178053.2-1545s1c1
Sequence:CCGGGCTCTACCTAAGGTAACCTTACTCGAGTAAGGTTACCTTAGGTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-936s1c1
Sequence:CCGGCCTCGGTTGCACTCGATCTATCTCGAGATAGATCGAGTGCAACCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-1235s1c1
Sequence:CCGGCGAACTAGTCAATCATGCCAACTCGAGTTGGCATGATTGACTAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-742s1c1
Sequence:CCGGCCGCAGTCATTACAGCCGCTACTCGAGTAGCGGCTGTAATGACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-596s1c1
Sequence:CCGGGCGGAATAACAGTCAGAAGATCTCGAGATCTTCTGACTGTTATTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178053.4-1094s21c1
Sequence:CCGGAGAGACCTGCAAACGTTGTTCCTCGAGGAACAACGTTTGCAGGTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178053
NAGS MISSION shRNA shRNA Plasmid DNA
N-acetylglutamate synthase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178053.4-637s21c1
Sequence:CCGGCGCTGACCTTGACCTTGTTACCTCGAGGTAACAAGGTCAAGGTCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178053.2-1545s1c1
Sequence:CCGGGCTCTACCTAAGGTAACCTTACTCGAGTAAGGTTACCTTAGGTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-936s1c1
Sequence:CCGGCCTCGGTTGCACTCGATCTATCTCGAGATAGATCGAGTGCAACCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-1235s1c1
Sequence:CCGGCGAACTAGTCAATCATGCCAACTCGAGTTGGCATGATTGACTAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-742s1c1
Sequence:CCGGCCGCAGTCATTACAGCCGCTACTCGAGTAGCGGCTGTAATGACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000076074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-596s1c1
Sequence:CCGGGCGGAATAACAGTCAGAAGATCTCGAGATCTTCTGACTGTTATTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178053.4-1094s21c1
Sequence:CCGGAGAGACCTGCAAACGTTGTTCCTCGAGGAACAACGTTTGCAGGTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178053
NAGS MISSION shRNA Lentiviral Transduction Particles
N-acetylglutamate synthase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178053.4-637s21c1
Sequence:CCGGCGCTGACCTTGACCTTGTTACCTCGAGGTAACAAGGTCAAGGTCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178053.2-1545s1c1
Sequence:CCGGGCTCTACCTAAGGTAACCTTACTCGAGTAAGGTTACCTTAGGTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-936s1c1
Sequence:CCGGCCTCGGTTGCACTCGATCTATCTCGAGATAGATCGAGTGCAACCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-1235s1c1
Sequence:CCGGCGAACTAGTCAATCATGCCAACTCGAGTTGGCATGATTGACTAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-742s1c1
Sequence:CCGGCCGCAGTCATTACAGCCGCTACTCGAGTAGCGGCTGTAATGACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000076074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178053.2-596s1c1
Sequence:CCGGGCGGAATAACAGTCAGAAGATCTCGAGATCTTCTGACTGTTATTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178053.4-1094s21c1
Sequence:CCGGAGAGACCTGCAAACGTTGTTCCTCGAGGAACAACGTTTGCAGGTCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153006
NAGS MISSION shRNA Bacterial Glycerol Stock
N-acetylglutamate synthase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-905s1c1
Sequence:CCGGGCAGTCATAAGGTCCTGAGTACTCGAGTACTCAGGACCTTATGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-1447s1c1
Sequence:CCGGCCCTGGTACTTCAAACACAGTCTCGAGACTGTGTTTGAAGTACCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-480s1c1
Sequence:CCGGCCTGGCCTTCTTGCAGCGCATCTCGAGATGCGCTGCAAGAAGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-894s1c1
Sequence:CCGGCCTGCGCGACAGCAGTCATAACTCGAGTTATGACTGCTGTCGCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-1067s1c1
Sequence:CCGGCGCTGCTCACTGAGCTCTTTACTCGAGTAAAGAGCTCAGTGAGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153006
NAGS MISSION shRNA shRNA Plasmid DNA
N-acetylglutamate synthase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-905s1c1
Sequence:CCGGGCAGTCATAAGGTCCTGAGTACTCGAGTACTCAGGACCTTATGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-1447s1c1
Sequence:CCGGCCCTGGTACTTCAAACACAGTCTCGAGACTGTGTTTGAAGTACCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-480s1c1
Sequence:CCGGCCTGGCCTTCTTGCAGCGCATCTCGAGATGCGCTGCAAGAAGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-894s1c1
Sequence:CCGGCCTGCGCGACAGCAGTCATAACTCGAGTTATGACTGCTGTCGCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-1067s1c1
Sequence:CCGGCGCTGCTCACTGAGCTCTTTACTCGAGTAAAGAGCTCAGTGAGCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153006
NAGS MISSION shRNA Lentiviral Transduction Particles
N-acetylglutamate synthase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-905s1c1
Sequence:CCGGGCAGTCATAAGGTCCTGAGTACTCGAGTACTCAGGACCTTATGACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-1447s1c1
Sequence:CCGGCCCTGGTACTTCAAACACAGTCTCGAGACTGTGTTTGAAGTACCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-480s1c1
Sequence:CCGGCCTGGCCTTCTTGCAGCGCATCTCGAGATGCGCTGCAAGAAGGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-894s1c1
Sequence:CCGGCCTGCGCGACAGCAGTCATAACTCGAGTTATGACTGCTGTCGCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153006.1-1067s1c1
Sequence:CCGGCGCTGCTCACTGAGCTCTTTACTCGAGTAAAGAGCTCAGTGAGCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)