EMAIL THIS PAGE TO A FRIEND

NAIF1

nuclear apoptosis inducing factor 1

65 Gene Product Result for
Synonyms: C9orf90 RP11-379C10.2 bA379C10.2
UniProtKB ID: Q69YI7, B3KV81, Q8WU12
Gene ID:
Mouse(71254) nuclear apoptosis inducing factor 1
Rat(687739) nuclear apoptosis inducing factor 1
Zebrafish(562755) nuclear apoptosis inducing factor 1
domestic cat(101095206) nuclear apoptosis inducing factor 1
dog(491322) nuclear apoptosis inducing factor 1
cow(510689) nuclear apoptosis inducing factor 1
chicken(417229) nuclear apoptosis inducing factor 1
sheep(101122260) nuclear apoptosis inducing factor 1
naked mole-rat(101715451) nuclear apoptosis inducing factor 1
domestic guinea pig(100723458) nuclear apoptosis inducing factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_197956 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_197956 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_197956 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194335 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194335 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194335 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_197956 Rosetta Predictions human pricing
XM_001079981 Rosetta Predictions rat pricing
NM_194335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057697 predicted 639
2 SASI_Hs01_00057698 predicted 1297
3 SASI_Hs01_00057700 predicted 1059
4 SASI_Hs01_00057701 predicted 874
5 SASI_Hs01_00057702 predicted 707
6 SASI_Hs01_00057703 predicted 1401
7 SASI_Hs01_00057704 predicted 1414
8 SASI_Hs01_00057705 predicted 1387
9 SASI_Hs01_00057706 predicted 1043
10 SASI_Hs02_00371557 predicted 1013
11 SASI_Hs01_00057699 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366164 predicted 3255
2 SASI_Rn02_00366165 predicted 3058
3 SASI_Rn02_00366166 predicted 3544
4 SASI_Rn02_00366167 predicted 2482
5 SASI_Rn02_00366168 predicted 3508
6 SASI_Rn02_00366169 predicted 2697
7 SASI_Rn02_00366170 predicted 3103
8 SASI_Rn02_00366171 predicted 3329
9 SASI_Rn02_00366172 predicted 3479
10 SASI_Rn02_00366173 predicted 3129
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132700 predicted 2367
2 SASI_Mm01_00132701 predicted 2403
3 SASI_Mm01_00132702 predicted 2682
4 SASI_Mm01_00132703 predicted 2944
5 SASI_Mm02_00350610 predicted 2928
6 SASI_Mm01_00132704 predicted 2868
7 SASI_Mm02_00350611 predicted 2806
8 SASI_Mm02_00350612 predicted 2271
9 SASI_Mm02_00350613 predicted 2411
10 SASI_Mm02_00350614 predicted 2220
11 SASI_Mm01_00132705 predicted 2616
12 SASI_Mm01_00132706 predicted 2627
13 SASI_Mm01_00132707 predicted 2449
14 SASI_Mm01_00132708 predicted 2689
15 SASI_Mm01_00132709 predicted 2617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197956
NAIF1 MISSION shRNA Bacterial Glycerol Stock
nuclear apoptosis inducing factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-391s1c1
Sequence:CCGGCCATGCAACAACGTATCTGCACTCGAGTGCAGATACGTTGTTGCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-396s1c1
Sequence:CCGGCAACAACGTATCTGCAACCTGCTCGAGCAGGTTGCAGATACGTTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197956.1-3031s1c1
Sequence:CCGGCCTGAGGACTTGGTTTGGTTTCTCGAGAAACCAAACCAAGTCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-395s1c1
Sequence:CCGGGCAACAACGTATCTGCAACCTCTCGAGAGGTTGCAGATACGTTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197956.1-2672s1c1
Sequence:CCGGGCCACATATGACCAATGGTTACTCGAGTAACCATTGGTCATATGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-392s1c1
Sequence:CCGGCATGCAACAACGTATCTGCAACTCGAGTTGCAGATACGTTGTTGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-218s1c1
Sequence:CCGGGAAGAAGTGGTCTGACCTCAACTCGAGTTGAGGTCAGACCACTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197956.1-2052s1c1
Sequence:CCGGGCTGAGTGAATCCAAAGCCATCTCGAGATGGCTTTGGATTCACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-213s1c1
Sequence:CCGGGTCAAGAAGAAGTGGTCTGACCTCGAGGTCAGACCACTTCTTCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197956
NAIF1 MISSION shRNA shRNA Plasmid DNA
nuclear apoptosis inducing factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-391s1c1
Sequence:CCGGCCATGCAACAACGTATCTGCACTCGAGTGCAGATACGTTGTTGCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-396s1c1
Sequence:CCGGCAACAACGTATCTGCAACCTGCTCGAGCAGGTTGCAGATACGTTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197956.1-3031s1c1
Sequence:CCGGCCTGAGGACTTGGTTTGGTTTCTCGAGAAACCAAACCAAGTCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-395s1c1
Sequence:CCGGGCAACAACGTATCTGCAACCTCTCGAGAGGTTGCAGATACGTTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197956.1-2672s1c1
Sequence:CCGGGCCACATATGACCAATGGTTACTCGAGTAACCATTGGTCATATGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-392s1c1
Sequence:CCGGCATGCAACAACGTATCTGCAACTCGAGTTGCAGATACGTTGTTGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-218s1c1
Sequence:CCGGGAAGAAGTGGTCTGACCTCAACTCGAGTTGAGGTCAGACCACTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197956.1-2052s1c1
Sequence:CCGGGCTGAGTGAATCCAAAGCCATCTCGAGATGGCTTTGGATTCACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-213s1c1
Sequence:CCGGGTCAAGAAGAAGTGGTCTGACCTCGAGGTCAGACCACTTCTTCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197956
NAIF1 MISSION shRNA Lentiviral Transduction Particles
nuclear apoptosis inducing factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-391s1c1
Sequence:CCGGCCATGCAACAACGTATCTGCACTCGAGTGCAGATACGTTGTTGCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-396s1c1
Sequence:CCGGCAACAACGTATCTGCAACCTGCTCGAGCAGGTTGCAGATACGTTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197956.1-3031s1c1
Sequence:CCGGCCTGAGGACTTGGTTTGGTTTCTCGAGAAACCAAACCAAGTCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-395s1c1
Sequence:CCGGGCAACAACGTATCTGCAACCTCTCGAGAGGTTGCAGATACGTTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197956.1-2672s1c1
Sequence:CCGGGCCACATATGACCAATGGTTACTCGAGTAACCATTGGTCATATGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-392s1c1
Sequence:CCGGCATGCAACAACGTATCTGCAACTCGAGTTGCAGATACGTTGTTGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-218s1c1
Sequence:CCGGGAAGAAGTGGTCTGACCTCAACTCGAGTTGAGGTCAGACCACTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165253    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197956.1-2052s1c1
Sequence:CCGGGCTGAGTGAATCCAAAGCCATCTCGAGATGGCTTTGGATTCACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197956.1-213s1c1
Sequence:CCGGGTCAAGAAGAAGTGGTCTGACCTCGAGGTCAGACCACTTCTTCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194335
NAIF1 MISSION shRNA Bacterial Glycerol Stock
nuclear apoptosis inducing factor 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2180s1c1
Sequence:CCGGCCGAAGTCAAGAAGAAGTGGTCTCGAGACCACTTCTTCTTGACTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2871s1c1
Sequence:CCGGCCGACGCTACCTACAGAATAACTCGAGTTATTCTGTAGGTAGCGTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2608s1c1
Sequence:CCGGCCAGACACATCTGTCAAACCACTCGAGTGGTTTGACAGATGTGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2071s1c1
Sequence:CCGGCTGCTGGTGAACCACTTCAATCTCGAGATTGAAGTGGTTCACCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2074s1c1
Sequence:CCGGCTGGTGAACCACTTCAATGCTCTCGAGAGCATTGAAGTGGTTCACCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194335.1-2996s1c1
Sequence:CCGGGTGATTGAAGGACACGTCTATCTCGAGATAGACGTGTCCTTCAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194335
NAIF1 MISSION shRNA shRNA Plasmid DNA
nuclear apoptosis inducing factor 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2180s1c1
Sequence:CCGGCCGAAGTCAAGAAGAAGTGGTCTCGAGACCACTTCTTCTTGACTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2871s1c1
Sequence:CCGGCCGACGCTACCTACAGAATAACTCGAGTTATTCTGTAGGTAGCGTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2608s1c1
Sequence:CCGGCCAGACACATCTGTCAAACCACTCGAGTGGTTTGACAGATGTGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2071s1c1
Sequence:CCGGCTGCTGGTGAACCACTTCAATCTCGAGATTGAAGTGGTTCACCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2074s1c1
Sequence:CCGGCTGGTGAACCACTTCAATGCTCTCGAGAGCATTGAAGTGGTTCACCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194335.1-2996s1c1
Sequence:CCGGGTGATTGAAGGACACGTCTATCTCGAGATAGACGTGTCCTTCAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194335
NAIF1 MISSION shRNA Lentiviral Transduction Particles
nuclear apoptosis inducing factor 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2180s1c1
Sequence:CCGGCCGAAGTCAAGAAGAAGTGGTCTCGAGACCACTTCTTCTTGACTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2871s1c1
Sequence:CCGGCCGACGCTACCTACAGAATAACTCGAGTTATTCTGTAGGTAGCGTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2608s1c1
Sequence:CCGGCCAGACACATCTGTCAAACCACTCGAGTGGTTTGACAGATGTGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2071s1c1
Sequence:CCGGCTGCTGGTGAACCACTTCAATCTCGAGATTGAAGTGGTTCACCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194335.1-2074s1c1
Sequence:CCGGCTGGTGAACCACTTCAATGCTCTCGAGAGCATTGAAGTGGTTCACCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194335.1-2996s1c1
Sequence:CCGGGTGATTGAAGGACACGTCTATCTCGAGATAGACGTGTCCTTCAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)