EMAIL THIS PAGE TO A FRIEND

NANOG

Nanog homeobox

81 Gene Product Result for
UniProtKB ID: Q9H9S0, D3DUU4, Q2TTG0, Q6JZS5
Gene ID:
Mouse(71950) Nanog homeobox
Rat(414065) Nanog homeobox
Goat(100860956) Nanog homeobox
sheep(100302345) Nanog homeobox
naked mole-rat(101724896) Nanog homeobox
Zebrafish(792333) nanog homeobox
chicken(100272166) nanog homeobox
dog(486701) Nanog homeobox
domestic cat(100174790) Nanog homeobox
cow(538951) Nanog homeobox
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301837 Anti-NANOG affinity isolated antibody human
immunohistochemistry pricing
AV100591 Anti-NANOG (AB1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2500670 Anti-NANOG antibody produced in goat affinity isolated antibody, buffered aqueous solution human, canine
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
N4413 Anti-Nanog antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4300680 Anti-Nanog antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
SAB3500389 Anti-NANOG antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2104002 Anti-NANOG antibody produced in rabbit affinity isolated antibody pig, rat, mouse, human, bovine
western blot pricing
N3038 Anti-Nanog antibody, Mouse monoclonal clone NNG-811, purified from hybridoma cell culture human
ELISA, immunocytochemistry, immunoprecipitation (IP), western blot pricing
SAB2104004 Anti-NANOG, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB2500671 Anti-NANOG, C-Terminal antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
AMAB91391 Monoclonal Anti-NANOG antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL5803, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0079923M1 Monoclonal Anti-NANOG antibody produced in mouse clone 2C11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
AMAB91393 Monoclonal Anti-NANOG antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL5810, purified immunoglobulin, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1405280 Monoclonal Anti-NANOG antibody produced in mouse clone 2E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1586 Human Nanog ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_132755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_132755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_132755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024865 MISSION® shRNA Lentiviral Transduction Particles human pricing

Related Products

Product # Description Species Add to Cart
 
ABD88 Anti-Mouse Nanog Antibody, N-Terminus This Anti-Mouse Nanog Antibody, N-Terminus is validated for use in Western Blotting and Immunocytochemistry for the detection of Mouse Nanog, N-Terminus. pricing
AB9220 Anti-Nanog Antibody This Anti-Nanog Antibody is validated for use in FC, WB for the detection of Nanog. pricing
MABD24 Anti-NANOG Antibody, clone 7F7.1 Anti-NANOG Antibody, clone 7F7.1 is an antibody against NANOG for use in Western Blotting, ICC. pricing
MABD24A4 Anti-NANOG Antibody, clone 7F7.1, Alexa Fluor® 488 conjugate Anti-NANOG Antibody, clone 7F7.1, Alexa Fluor 488 conjugate. pricing
MABD24C3 Anti-NANOG Antibody, clone 7F7.1, Cy3 conjugate Anti-NANOG Antibody, clone 7F7.1, Cy3 conjugate. pricing
17-655 ChIPAb+ Nanog Antibody - ChIP Validated Antibody and Primer Set Use ChIPAb+ Nanog ChIP Validated mouse monoclonal antibody for the detection of Nanog. pricing
SF-876 NANOG; Human, Cyanine 3 RNA Detection Probe | SmartFlare NANOG can be assayed in live cells using SmartFlare probes. The fluorescent reporter release can be detected by microscopy, flow cytometry, and FACS if enrichment of live cells based on NANOG levels is desired. pricing
SF-875 NANOG; Human, Cyanine 5, RNA Detection Probe | SmartFlare NANOG can be assayed in live cells using SmartFlare probes. The fluorescent reporter release can be detected by microscopy, flow cytometry, and FACS if enrichment of live cells based on NANOG levels is desired. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024865 Rosetta Predictions human pricing
NM_001100781 Rosetta Predictions rat pricing
NM_028016 Rosetta Predictions mouse pricing
XM_132755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163355 predicted 528
2 SASI_Hs01_00163357 predicted 686
3 SASI_Hs01_00163358 predicted 932
4 SASI_Hs01_00163359 predicted 974
5 SASI_Hs02_00357450 predicted 449
6 SASI_Hs02_00357451 predicted 440
7 SASI_Hs01_00163362 predicted 901
8 SASI_Hs01_00163364 predicted 414
9 SASI_Hs01_00163363 predicted 436
10 SASI_Hs02_00357452 predicted 492
11 SASI_Hs01_00163356 predicted 299
12 SASI_Hs01_00163360 predicted 449
13 SASI_Hs01_00163361 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210538 predicted 777
2 SASI_Rn02_00210539 predicted 441
3 SASI_Rn02_00210540 predicted 760
4 SASI_Rn02_00210541 predicted 994
5 SASI_Rn02_00210542 predicted 411
6 SASI_Rn02_00210543 predicted 398
7 SASI_Rn02_00210544 predicted 744
8 SASI_Rn02_00210545 predicted 380
9 SASI_Rn02_00210546 predicted 424
10 SASI_Rn02_00210547 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333133 predicted 696
2 SASI_Mm02_00333134 predicted 310
3 SASI_Mm02_00333135 predicted 806
4 SASI_Mm02_00333136 predicted 696
5 SASI_Mm02_00333137 predicted 405
6 SASI_Mm02_00333138 predicted 683
7 SASI_Mm02_00333139 predicted 680
8 SASI_Mm02_00333140 predicted 378
9 SASI_Mm02_00333141 predicted 780
10 SASI_Mm02_00333142 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209222 predicted 486
2 SASI_Mm01_00209223 predicted 472
3 SASI_Mm01_00209224 predicted 404
4 SASI_Mm01_00209225 predicted 468
5 SASI_Mm01_00209226 predicted 391
6 SASI_Mm01_00209227 predicted 465
7 SASI_Mm01_00209228 predicted 372
8 SASI_Mm01_00209229 predicted 377
9 SASI_Mm01_00209230 predicted 467
10 SASI_Mm01_00209231 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_132755
NANOG MISSION shRNA Bacterial Glycerol Stock
Nanog homeobox
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000075333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132755.3-1780s1c1
Sequence:CCGGGCCAACCTGTACTATGTTTAACTCGAGTTAAACATAGTACAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132755.3-817s1c1
Sequence:CCGGGCCAGTGATTTGGAGGTGAATCTCGAGATTCACCTCCAAATCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132755.3-417s1c1
Sequence:CCGGCCTGAGCTATAAGCAGGTTAACTCGAGTTAACCTGCTTATAGCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132755.3-486s1c1
Sequence:CCGGCCAGTGGTTGAAGACTAGCAACTCGAGTTGCTAGTCTTCAACCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_132755
NANOG MISSION shRNA shRNA Plasmid DNA
Nanog homeobox
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000075333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132755.3-1780s1c1
Sequence:CCGGGCCAACCTGTACTATGTTTAACTCGAGTTAAACATAGTACAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132755.3-817s1c1
Sequence:CCGGGCCAGTGATTTGGAGGTGAATCTCGAGATTCACCTCCAAATCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132755.3-417s1c1
Sequence:CCGGCCTGAGCTATAAGCAGGTTAACTCGAGTTAACCTGCTTATAGCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132755.3-486s1c1
Sequence:CCGGCCAGTGGTTGAAGACTAGCAACTCGAGTTGCTAGTCTTCAACCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_132755
NANOG MISSION shRNA Lentiviral Transduction Particles
Nanog homeobox
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000075333    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_132755.3-1780s1c1
Sequence:CCGGGCCAACCTGTACTATGTTTAACTCGAGTTAAACATAGTACAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132755.3-817s1c1
Sequence:CCGGGCCAGTGATTTGGAGGTGAATCTCGAGATTCACCTCCAAATCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132755.3-417s1c1
Sequence:CCGGCCTGAGCTATAAGCAGGTTAACTCGAGTTAACCTGCTTATAGCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_132755.3-486s1c1
Sequence:CCGGCCAGTGGTTGAAGACTAGCAACTCGAGTTGCTAGTCTTCAACCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024865
NANOG MISSION shRNA Bacterial Glycerol Stock
Nanog homeobox
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024865.1-1680s1c1
Sequence:CCGGGCTGCTAAGGACAACATTGATCTCGAGATCAATGTTGTCCTTAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024865.1-920s1c1
Sequence:CCGGCCTGGAACAGTCCCTTCTATACTCGAGTATAGAAGGGACTGTTCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024865.1-1095s1c1
Sequence:CCGGCCTAAACTACTCCATGAACATCTCGAGATGTTCATGGAGTAGTTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024865.1-254s1c1
Sequence:CCGGGCTTTGAAGCATCCGACTGTACTCGAGTACAGTCGGATGCTTCAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024865.2-1135s21c1
Sequence:CCGGAGATGAGTGAAACTGATATTACTCGAGTAATATCAGTTTCACTCATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024865.2-1047s21c1
Sequence:CCGGACAGCAGACCACTAGGTATTTCTCGAGAAATACCTAGTGGTCTGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024865.2-1286s21c1
Sequence:CCGGGAGTATGGTTGGAGCCTAATCCTCGAGGATTAGGCTCCAACCATACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024865.2-968s21c1
Sequence:CCGGGCATGCAGTTCCAGCCAAATTCTCGAGAATTTGGCTGGAACTGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024865
NANOG MISSION shRNA shRNA Plasmid DNA
Nanog homeobox
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024865.1-1680s1c1
Sequence:CCGGGCTGCTAAGGACAACATTGATCTCGAGATCAATGTTGTCCTTAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024865.1-920s1c1
Sequence:CCGGCCTGGAACAGTCCCTTCTATACTCGAGTATAGAAGGGACTGTTCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024865.1-1095s1c1
Sequence:CCGGCCTAAACTACTCCATGAACATCTCGAGATGTTCATGGAGTAGTTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024865.1-254s1c1
Sequence:CCGGGCTTTGAAGCATCCGACTGTACTCGAGTACAGTCGGATGCTTCAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024865.2-1135s21c1
Sequence:CCGGAGATGAGTGAAACTGATATTACTCGAGTAATATCAGTTTCACTCATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024865.2-1047s21c1
Sequence:CCGGACAGCAGACCACTAGGTATTTCTCGAGAAATACCTAGTGGTCTGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024865.2-1286s21c1
Sequence:CCGGGAGTATGGTTGGAGCCTAATCCTCGAGGATTAGGCTCCAACCATACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024865.2-968s21c1
Sequence:CCGGGCATGCAGTTCCAGCCAAATTCTCGAGAATTTGGCTGGAACTGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024865
NANOG MISSION shRNA Lentiviral Transduction Particles
Nanog homeobox
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004884    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024865.1-1680s1c1
Sequence:CCGGGCTGCTAAGGACAACATTGATCTCGAGATCAATGTTGTCCTTAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024865.1-920s1c1
Sequence:CCGGCCTGGAACAGTCCCTTCTATACTCGAGTATAGAAGGGACTGTTCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024865.1-1095s1c1
Sequence:CCGGCCTAAACTACTCCATGAACATCTCGAGATGTTCATGGAGTAGTTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024865.1-254s1c1
Sequence:CCGGGCTTTGAAGCATCCGACTGTACTCGAGTACAGTCGGATGCTTCAAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436615    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024865.2-1135s21c1
Sequence:CCGGAGATGAGTGAAACTGATATTACTCGAGTAATATCAGTTTCACTCATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024865.2-1047s21c1
Sequence:CCGGACAGCAGACCACTAGGTATTTCTCGAGAAATACCTAGTGGTCTGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024865.2-1286s21c1
Sequence:CCGGGAGTATGGTTGGAGCCTAATCCTCGAGGATTAGGCTCCAACCATACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024865.2-968s21c1
Sequence:CCGGGCATGCAGTTCCAGCCAAATTCTCGAGAATTTGGCTGGAACTGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)