EMAIL THIS PAGE TO A FRIEND

NANOS1

nanos homolog 1 (Drosophila)

84 Gene Product Result for
Synonyms: NOS1
UniProtKB ID: Q8WY41
Gene ID:
Mouse(332397) nanos homolog 1 (Drosophila)
Rat(365494) nanos homolog 1 (Drosophila)
sheep(101122152) nanos homolog 1 (Drosophila)
domestic guinea pig(100717709) nanos homolog 1 (Drosophila)
naked mole-rat(101721183) nanos homolog 1 (Drosophila)
Zebrafish(322903) nanos homolog 1
cow(786356) nanos homolog 1 (Drosophila)
dog(100683604) nanos homolog 1 (Drosophila)
chicken(100857342) nanos homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_199461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_199461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_199461 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009553 Rosetta Predictions human pricing
NM_199461 Rosetta Predictions human pricing
XM_001066273 Rosetta Predictions rat pricing
XM_345053 Rosetta Predictions rat pricing
NM_178421 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009553 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132144 predicted 652
2 SASI_Hs01_00132145 predicted 823
3 SASI_Hs01_00132146 predicted 550
4 SASI_Hs01_00132147 predicted 824
5 SASI_Hs01_00132148 predicted 430
6 SASI_Hs01_00132149 predicted 814
7 SASI_Hs01_00132150 predicted 550
8 SASI_Hs01_00132151 predicted 818
9 SASI_Hs01_00132152 predicted 556
10 SASI_Hs01_00132153 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178995 predicted 1339
2 SASI_Hs01_00178996 predicted 1236
3 SASI_Hs01_00178997 predicted 846
4 SASI_Hs01_00178998 predicted 1304
5 SASI_Hs01_00178999 predicted 1113
6 SASI_Hs01_00179000 predicted 1374
7 SASI_Hs01_00179001 predicted 1261
8 SASI_Hs01_00179002 predicted 751
9 SASI_Hs01_00179003 predicted 1237
10 SASI_Hs01_00179004 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066273 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316898 predicted 1193
2 SASI_Rn02_00316899 predicted 1292
3 SASI_Rn02_00316900 predicted 1040
4 SASI_Rn02_00316901 predicted 1181
5 SASI_Rn02_00316902 predicted 1328
6 SASI_Rn02_00316903 predicted 853
7 SASI_Rn02_00316904 predicted 710
8 SASI_Rn02_00316905 predicted 1276
9 SASI_Rn02_00316906 predicted 1118
10 SASI_Rn02_00316907 predicted 1156
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345053 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397901 predicted 1193
2 SASI_Rn02_00397902 predicted 1287
3 SASI_Rn02_00397903 predicted 1182
4 SASI_Rn02_00397904 predicted 1190
5 SASI_Rn02_00397905 predicted 1291
6 SASI_Rn02_00397906 predicted 1252
7 SASI_Rn02_00397907 predicted 1291
8 SASI_Rn02_00397908 predicted 1276
9 SASI_Rn02_00397909 predicted 1124
10 SASI_Rn02_00397910 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109637 predicted 1552
2 SASI_Mm01_00109638 predicted 1369
3 SASI_Mm01_00109639 predicted 961
4 SASI_Mm01_00109640 predicted 1200
5 SASI_Mm01_00109641 predicted 730
6 SASI_Mm01_00109642 predicted 1395
7 SASI_Mm01_00109643 predicted 1312
8 SASI_Mm01_00109644 predicted 1390
9 SASI_Mm01_00109645 predicted 1303
10 SASI_Mm02_00348892 predicted 1060
11 SASI_Mm01_00109636 predicted 1355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199461
NANOS1 MISSION shRNA Bacterial Glycerol Stock
nanos homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199461.2-203s21c1
Sequence:CCGGCTTCAGCTCCTGGAACGACTACTCGAGTAGTCGTTCCAGGAGCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199461.2-1239s21c1
Sequence:CCGGGCAACTTAGAGGCGCTGTTTACTCGAGTAAACAGCGCCTCTAAGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199461.2-874s21c1
Sequence:CCGGAGTACTGCCCGCTCTCCAAAGCTCGAGCTTTGGAGAGCGGGCAGTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199461.2-1250s1c1
Sequence:CCGGGCGCTGTTTATTTACTGTATACTCGAGTATACAGTAAATAAACAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-737s1c1
Sequence:CCGGCCGGAACAACAAGGAGGCGATCTCGAGATCGCCTCCTTGTTGTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-857s1c1
Sequence:CCGGCAACGCGCACACCATCAAGTACTCGAGTACTTGATGGTGTGCGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-851s1c1
Sequence:CCGGCGGCGACAACGCGCACACCATCTCGAGATGGTGTGCGCGTTGTCGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-764s1c1
Sequence:CCGGCTACACCACCCATATCCTCAACTCGAGTTGAGGATATGGGTGGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199461.2-1263s21c1
Sequence:CCGGACTGTATACGTCGACCTATTTCTCGAGAAATAGGTCGACGTATACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199461
NANOS1 MISSION shRNA shRNA Plasmid DNA
nanos homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199461.2-203s21c1
Sequence:CCGGCTTCAGCTCCTGGAACGACTACTCGAGTAGTCGTTCCAGGAGCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199461.2-1239s21c1
Sequence:CCGGGCAACTTAGAGGCGCTGTTTACTCGAGTAAACAGCGCCTCTAAGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199461.2-874s21c1
Sequence:CCGGAGTACTGCCCGCTCTCCAAAGCTCGAGCTTTGGAGAGCGGGCAGTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199461.2-1250s1c1
Sequence:CCGGGCGCTGTTTATTTACTGTATACTCGAGTATACAGTAAATAAACAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-737s1c1
Sequence:CCGGCCGGAACAACAAGGAGGCGATCTCGAGATCGCCTCCTTGTTGTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-857s1c1
Sequence:CCGGCAACGCGCACACCATCAAGTACTCGAGTACTTGATGGTGTGCGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-851s1c1
Sequence:CCGGCGGCGACAACGCGCACACCATCTCGAGATGGTGTGCGCGTTGTCGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-764s1c1
Sequence:CCGGCTACACCACCCATATCCTCAACTCGAGTTGAGGATATGGGTGGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199461.2-1263s21c1
Sequence:CCGGACTGTATACGTCGACCTATTTCTCGAGAAATAGGTCGACGTATACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199461
NANOS1 MISSION shRNA Lentiviral Transduction Particles
nanos homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199461.2-203s21c1
Sequence:CCGGCTTCAGCTCCTGGAACGACTACTCGAGTAGTCGTTCCAGGAGCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424740    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199461.2-1239s21c1
Sequence:CCGGGCAACTTAGAGGCGCTGTTTACTCGAGTAAACAGCGCCTCTAAGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_199461.2-874s21c1
Sequence:CCGGAGTACTGCCCGCTCTCCAAAGCTCGAGCTTTGGAGAGCGGGCAGTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199461.2-1250s1c1
Sequence:CCGGGCGCTGTTTATTTACTGTATACTCGAGTATACAGTAAATAAACAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-737s1c1
Sequence:CCGGCCGGAACAACAAGGAGGCGATCTCGAGATCGCCTCCTTGTTGTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-857s1c1
Sequence:CCGGCAACGCGCACACCATCAAGTACTCGAGTACTTGATGGTGTGCGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-851s1c1
Sequence:CCGGCGGCGACAACGCGCACACCATCTCGAGATGGTGTGCGCGTTGTCGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199461.2-764s1c1
Sequence:CCGGCTACACCACCCATATCCTCAACTCGAGTTGAGGATATGGGTGGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413676    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_199461.2-1263s21c1
Sequence:CCGGACTGTATACGTCGACCTATTTCTCGAGAAATAGGTCGACGTATACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178421
NANOS1 MISSION shRNA Bacterial Glycerol Stock
nanos homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-152s1c1
Sequence:CCGGGCGTTGGAACTGCGCGCACTACTCGAGTAGTGCGCGCAGTTCCAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178421.2-1508s1c1
Sequence:CCGGCCCACCTTGATTGCTCAAGTTCTCGAGAACTTGAGCAATCAAGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-553s1c1
Sequence:CCGGCAACGCACATACCATCAAGTACTCGAGTACTTGATGGTATGTGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-640s1c1
Sequence:CCGGGCCCAGCAAGAAGCTGCGCTACTCGAGTAGCGCAGCTTCTTGCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-221s1c1
Sequence:CCGGGCTGAGCTGAACCCGTTTGCACTCGAGTGCAAACGGGTTCAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178421
NANOS1 MISSION shRNA shRNA Plasmid DNA
nanos homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-152s1c1
Sequence:CCGGGCGTTGGAACTGCGCGCACTACTCGAGTAGTGCGCGCAGTTCCAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178421.2-1508s1c1
Sequence:CCGGCCCACCTTGATTGCTCAAGTTCTCGAGAACTTGAGCAATCAAGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-553s1c1
Sequence:CCGGCAACGCACATACCATCAAGTACTCGAGTACTTGATGGTATGTGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-640s1c1
Sequence:CCGGGCCCAGCAAGAAGCTGCGCTACTCGAGTAGCGCAGCTTCTTGCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-221s1c1
Sequence:CCGGGCTGAGCTGAACCCGTTTGCACTCGAGTGCAAACGGGTTCAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178421
NANOS1 MISSION shRNA Lentiviral Transduction Particles
nanos homolog 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-152s1c1
Sequence:CCGGGCGTTGGAACTGCGCGCACTACTCGAGTAGTGCGCGCAGTTCCAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096769    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178421.2-1508s1c1
Sequence:CCGGCCCACCTTGATTGCTCAAGTTCTCGAGAACTTGAGCAATCAAGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-553s1c1
Sequence:CCGGCAACGCACATACCATCAAGTACTCGAGTACTTGATGGTATGTGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-640s1c1
Sequence:CCGGGCCCAGCAAGAAGCTGCGCTACTCGAGTAGCGCAGCTTCTTGCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178421.2-221s1c1
Sequence:CCGGGCTGAGCTGAACCCGTTTGCACTCGAGTGCAAACGGGTTCAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)