EMAIL THIS PAGE TO A FRIEND

NANOS2

nanos homolog 2 (Drosophila)

53 Gene Product Result for
Synonyms: NOS2
UniProtKB ID: P60321, Q17R30, Q4G0P8
Gene ID:
Mouse(378430) nanos homolog 2 (Drosophila)
Rat(365213) nanos homolog 2 (Drosophila)
cow(100299090) nanos homolog 2 (Drosophila)
domestic cat(101092220) nanos homolog 2 (Drosophila)
dog(484432) nanos homolog 2 (Drosophila)
naked mole-rat(101717975) nanos homolog 2 (Drosophila)
domestic guinea pig(100724078) nanos homolog 2 (Drosophila)
sheep(101115150) nanos homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194064 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194064 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194064 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001029861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029861 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029861 Rosetta Predictions human pricing
NM_001108908 Rosetta Predictions rat pricing
NM_194064 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094069 predicted 842
2 SASI_Hs01_00094070 predicted 557
3 SASI_Hs01_00094071 predicted 920
4 SASI_Hs01_00094072 predicted 508
5 SASI_Hs01_00094073 predicted 895
6 SASI_Hs01_00094074 predicted 844
7 SASI_Hs01_00094075 predicted 497
8 SASI_Hs01_00094076 predicted 842
9 SASI_Hs01_00094077 predicted 937
10 SASI_Hs01_00094078 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243275 predicted 340
2 SASI_Rn02_00243276 predicted 341
3 SASI_Rn02_00243277 predicted 745
4 SASI_Rn02_00243278 predicted 798
5 SASI_Rn02_00243279 predicted 346
6 SASI_Rn02_00243280 predicted 244
7 SASI_Rn02_00243281 predicted 695
8 SASI_Rn02_00243282 predicted 925
9 SASI_Rn02_00243283 predicted 915
10 SASI_Rn02_00243284 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194064 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069419 predicted 632
2 SASI_Mm02_00350583 predicted 348
3 SASI_Mm01_00069412 predicted 342
4 SASI_Mm01_00069413 predicted 483
5 SASI_Mm01_00069421 predicted 658
6 SASI_Mm02_00350584 predicted 659
7 SASI_Mm02_00350585 predicted 354
8 SASI_Mm02_00350586 predicted 889
9 SASI_Mm02_00350587 predicted 749
10 SASI_Mm01_00069414 predicted 436
11 SASI_Mm01_00069415 predicted 418
12 SASI_Mm01_00069416 predicted 400
13 SASI_Mm01_00069417 predicted 254
14 SASI_Mm01_00069418 predicted 507
15 SASI_Mm01_00069420 predicted 104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194064
NANOS2 MISSION shRNA Bacterial Glycerol Stock
nanos homolog 2 (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-393s1c1
Sequence:CCGGCCAGGCTCATACACTCAAGTACTCGAGTACTTGAGTGTATGAGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-127s1c1
Sequence:CCGGAGCCAGGTGGTGATGGATATACTCGAGTATATCCATCACCACCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194064.1-1236s1c1
Sequence:CCGGCCAATATAGTTGAGTGTGTTACTCGAGTAACACACTCAACTATATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-355s1c1
Sequence:CCGGAGGCACTATGTGTGTCCTCTACTCGAGTAGAGGACACACATAGTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-394s1c1
Sequence:CCGGCAGGCTCATACACTCAAGTATCTCGAGATACTTGAGTGTATGAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194064.2-749s21c1
Sequence:CCGGACTTCTCGGTTCCTCTCTAAACTCGAGTTTAGAGAGGAACCGAGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194064.2-289s21c1
Sequence:CCGGTCTCGTCACGTCTACACCTCACTCGAGTGAGGTGTAGACGTGACGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194064
NANOS2 MISSION shRNA shRNA Plasmid DNA
nanos homolog 2 (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-393s1c1
Sequence:CCGGCCAGGCTCATACACTCAAGTACTCGAGTACTTGAGTGTATGAGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-127s1c1
Sequence:CCGGAGCCAGGTGGTGATGGATATACTCGAGTATATCCATCACCACCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194064.1-1236s1c1
Sequence:CCGGCCAATATAGTTGAGTGTGTTACTCGAGTAACACACTCAACTATATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-355s1c1
Sequence:CCGGAGGCACTATGTGTGTCCTCTACTCGAGTAGAGGACACACATAGTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-394s1c1
Sequence:CCGGCAGGCTCATACACTCAAGTATCTCGAGATACTTGAGTGTATGAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194064.2-749s21c1
Sequence:CCGGACTTCTCGGTTCCTCTCTAAACTCGAGTTTAGAGAGGAACCGAGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194064.2-289s21c1
Sequence:CCGGTCTCGTCACGTCTACACCTCACTCGAGTGAGGTGTAGACGTGACGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194064
NANOS2 MISSION shRNA Lentiviral Transduction Particles
nanos homolog 2 (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-393s1c1
Sequence:CCGGCCAGGCTCATACACTCAAGTACTCGAGTACTTGAGTGTATGAGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-127s1c1
Sequence:CCGGAGCCAGGTGGTGATGGATATACTCGAGTATATCCATCACCACCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194064.1-1236s1c1
Sequence:CCGGCCAATATAGTTGAGTGTGTTACTCGAGTAACACACTCAACTATATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-355s1c1
Sequence:CCGGAGGCACTATGTGTGTCCTCTACTCGAGTAGAGGACACACATAGTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194064.1-394s1c1
Sequence:CCGGCAGGCTCATACACTCAAGTATCTCGAGATACTTGAGTGTATGAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445797    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194064.2-749s21c1
Sequence:CCGGACTTCTCGGTTCCTCTCTAAACTCGAGTTTAGAGAGGAACCGAGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194064.2-289s21c1
Sequence:CCGGTCTCGTCACGTCTACACCTCACTCGAGTGAGGTGTAGACGTGACGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029861
NANOS2 MISSION shRNA Bacterial Glycerol Stock
nanos homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029861.1-949s1c1
Sequence:CCGGCCTACTCAAGAACTTCAAGATCTCGAGATCTTGAAGTTCTTGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-415s1c1
Sequence:CCGGACGCTCAAGTACTGCCCGCTTCTCGAGAAGCGGGCAGTACTTGAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-182s1c1
Sequence:CCGGCCCAAGAGATTGAGGAGCCAACTCGAGTTGGCTCCTCAATCTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-267s1c1
Sequence:CCGGGACCCTGTGCAACTTCTGCAACTCGAGTTGCAGAAGTTGCACAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-405s1c1
Sequence:CCGGCCAGGCCCATACGCTCAAGTACTCGAGTACTTGAGCGTATGGGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029861.2-111s21c1
Sequence:CCGGGGAAGGACTACTTCAACCTGACTCGAGTCAGGTTGAAGTAGTCCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029861.2-495s21c1
Sequence:CCGGAGCGCTGAGCATCGTGAGATGCTCGAGCATCTCACGATGCTCAGCGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029861.2-851s21c1
Sequence:CCGGCCTTGTGGAGTTCTTGGATTTCTCGAGAAATCCAAGAACTCCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029861
NANOS2 MISSION shRNA shRNA Plasmid DNA
nanos homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029861.1-949s1c1
Sequence:CCGGCCTACTCAAGAACTTCAAGATCTCGAGATCTTGAAGTTCTTGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-415s1c1
Sequence:CCGGACGCTCAAGTACTGCCCGCTTCTCGAGAAGCGGGCAGTACTTGAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-182s1c1
Sequence:CCGGCCCAAGAGATTGAGGAGCCAACTCGAGTTGGCTCCTCAATCTCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-267s1c1
Sequence:CCGGGACCCTGTGCAACTTCTGCAACTCGAGTTGCAGAAGTTGCACAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-405s1c1
Sequence:CCGGCCAGGCCCATACGCTCAAGTACTCGAGTACTTGAGCGTATGGGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000451403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029861.2-111s21c1
Sequence:CCGGGGAAGGACTACTTCAACCTGACTCGAGTCAGGTTGAAGTAGTCCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029861.2-495s21c1
Sequence:CCGGAGCGCTGAGCATCGTGAGATGCTCGAGCATCTCACGATGCTCAGCGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029861.2-851s21c1
Sequence:CCGGCCTTGTGGAGTTCTTGGATTTCTCGAGAAATCCAAGAACTCCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029861
NANOS2 MISSION shRNA Lentiviral Transduction Particles
nanos homolog 2 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029861.1-949s1c1
Sequence:CCGGCCTACTCAAGAACTTCAAGATCTCGAGATCTTGAAGTTCTTGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-415s1c1
Sequence:CCGGACGCTCAAGTACTGCCCGCTTCTCGAGAAGCGGGCAGTACTTGAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-182s1c1
Sequence:CCGGCCCAAGAGATTGAGGAGCCAACTCGAGTTGGCTCCTCAATCTCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-267s1c1
Sequence:CCGGGACCCTGTGCAACTTCTGCAACTCGAGTTGCAGAAGTTGCACAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029861.1-405s1c1
Sequence:CCGGCCAGGCCCATACGCTCAAGTACTCGAGTACTTGAGCGTATGGGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451403    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029861.2-111s21c1
Sequence:CCGGGGAAGGACTACTTCAACCTGACTCGAGTCAGGTTGAAGTAGTCCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029861.2-495s21c1
Sequence:CCGGAGCGCTGAGCATCGTGAGATGCTCGAGCATCTCACGATGCTCAGCGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029861.2-851s21c1
Sequence:CCGGCCTTGTGGAGTTCTTGGATTTCTCGAGAAATCCAAGAACTCCACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)