EMAIL THIS PAGE TO A FRIEND

NANOS3

nanos homolog 3 (Drosophila)

45 Gene Product Result for
Synonyms: NANOS1L NOS3
UniProtKB ID: P60323, Q495E5
Gene ID:
Mouse(244551) nanos homolog 3 (Drosophila)
Rat(288909) nanos homolog 3 (Drosophila)
sheep(101120409) nanos homolog 3 (Drosophila)
domestic guinea pig(100724463) nanos homolog 3 (Drosophila)
naked mole-rat(101699943) nanos homolog 3 (Drosophila)
Zebrafish(140631) nanos homolog 3
dog(484912) nanos homolog 3 (Drosophila)
cow(523375) nanos homolog 3 (Drosophila)
domestic cat(101089497) nanos homolog 3 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098622 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_194059 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_194059 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_194059 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098622 Rosetta Predictions human pricing
NM_001105945 Rosetta Predictions rat pricing
NM_194059 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319526 predicted 360
2 SASI_Hs02_00319527 predicted 470
3 SASI_Hs02_00319528 predicted 328
4 SASI_Hs02_00319529 predicted 540
5 SASI_Hs02_00319530 predicted 627
6 SASI_Hs02_00319531 predicted 663
7 SASI_Hs02_00319532 predicted 477
8 SASI_Hs02_00319533 predicted 414
9 SASI_Hs02_00319534 predicted 408
10 SASI_Hs02_00319535 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105945 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214092 predicted 342
2 SASI_Rn02_00214093 predicted 211
3 SASI_Rn02_00214094 predicted 266
4 SASI_Rn02_00214095 predicted 358
5 SASI_Rn02_00214096 predicted 362
6 SASI_Rn02_00214097 predicted 210
7 SASI_Rn02_00214098 predicted 230
8 SASI_Rn02_00214099 predicted 339
9 SASI_Rn02_00214100 predicted 233
10 SASI_Rn02_00214101 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194059 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068233 predicted 359
2 SASI_Mm01_00068234 predicted 204
3 SASI_Mm01_00068235 predicted 405
4 SASI_Mm01_00068236 predicted 260
5 SASI_Mm02_00350581 predicted 207
6 SASI_Mm01_00068237 predicted 256
7 SASI_Mm01_00068238 predicted 406
8 SASI_Mm01_00068239 predicted 212
9 SASI_Mm01_00068240 predicted 384
10 SASI_Mm01_00068241 predicted 356
11 SASI_Mm01_00068242 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098622
NANOS3 MISSION shRNA Bacterial Glycerol Stock
nanos homolog 3 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-337s21c1
Sequence:CCGGGCCTGTGCTCTTTCTGCAAACCTCGAGGTTTGCAGAAAGAGCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-176s21c1
Sequence:CCGGTGGGAAAGAGGGTCCTGAAACCTCGAGGTTTCAGGACCCTCTTTCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-145s21c1
Sequence:CCGGTGGGTTTGGCACACCTGGTTACTCGAGTAACCAGGTGTGCCAAACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-486s21c1
Sequence:CCGGCGACGCTTCTGCCCACTTACTCTCGAGAGTAAGTGGGCAGAAGCGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098622.1-739s21c1
Sequence:CCGGCCAGGAAGACCCACCCTATGACTCGAGTCATAGGGTGGGTCTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098622
NANOS3 MISSION shRNA shRNA Plasmid DNA
nanos homolog 3 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-337s21c1
Sequence:CCGGGCCTGTGCTCTTTCTGCAAACCTCGAGGTTTGCAGAAAGAGCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-176s21c1
Sequence:CCGGTGGGAAAGAGGGTCCTGAAACCTCGAGGTTTCAGGACCCTCTTTCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-145s21c1
Sequence:CCGGTGGGTTTGGCACACCTGGTTACTCGAGTAACCAGGTGTGCCAAACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-486s21c1
Sequence:CCGGCGACGCTTCTGCCCACTTACTCTCGAGAGTAAGTGGGCAGAAGCGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000253723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098622.1-739s21c1
Sequence:CCGGCCAGGAAGACCCACCCTATGACTCGAGTCATAGGGTGGGTCTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098622
NANOS3 MISSION shRNA Lentiviral Transduction Particles
nanos homolog 3 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-337s21c1
Sequence:CCGGGCCTGTGCTCTTTCTGCAAACCTCGAGGTTTGCAGAAAGAGCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-176s21c1
Sequence:CCGGTGGGAAAGAGGGTCCTGAAACCTCGAGGTTTCAGGACCCTCTTTCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-145s21c1
Sequence:CCGGTGGGTTTGGCACACCTGGTTACTCGAGTAACCAGGTGTGCCAAACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098622.1-486s21c1
Sequence:CCGGCGACGCTTCTGCCCACTTACTCTCGAGAGTAAGTGGGCAGAAGCGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000253723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098622.1-739s21c1
Sequence:CCGGCCAGGAAGACCCACCCTATGACTCGAGTCATAGGGTGGGTCTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194059
NANOS3 MISSION shRNA Bacterial Glycerol Stock
nanos homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194059.1-617s1c1
Sequence:CCGGGCTGGAGACTGGACCTTGCTTCTCGAGAAGCAAGGTCCAGTCTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-173s1c1
Sequence:CCGGCAGCTCCTGAACGCTTATGTTCTCGAGAACATAAGCGTTCAGGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-362s1c1
Sequence:CCGGGCTACACTTCTGTCTACTGCTCTCGAGAGCAGTAGACAGAAGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-477s1c1
Sequence:CCGGAGGTGTCTATGCAGGTTCCAACTCGAGTTGGAACCTGCATAGACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-220s1c1
Sequence:CCGGCGTGCCATCTATCAGTCCCATCTCGAGATGGGACTGATAGATGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194059
NANOS3 MISSION shRNA shRNA Plasmid DNA
nanos homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194059.1-617s1c1
Sequence:CCGGGCTGGAGACTGGACCTTGCTTCTCGAGAAGCAAGGTCCAGTCTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-173s1c1
Sequence:CCGGCAGCTCCTGAACGCTTATGTTCTCGAGAACATAAGCGTTCAGGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-362s1c1
Sequence:CCGGGCTACACTTCTGTCTACTGCTCTCGAGAGCAGTAGACAGAAGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-477s1c1
Sequence:CCGGAGGTGTCTATGCAGGTTCCAACTCGAGTTGGAACCTGCATAGACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000096786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-220s1c1
Sequence:CCGGCGTGCCATCTATCAGTCCCATCTCGAGATGGGACTGATAGATGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194059
NANOS3 MISSION shRNA Lentiviral Transduction Particles
nanos homolog 3 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194059.1-617s1c1
Sequence:CCGGGCTGGAGACTGGACCTTGCTTCTCGAGAAGCAAGGTCCAGTCTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-173s1c1
Sequence:CCGGCAGCTCCTGAACGCTTATGTTCTCGAGAACATAAGCGTTCAGGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-362s1c1
Sequence:CCGGGCTACACTTCTGTCTACTGCTCTCGAGAGCAGTAGACAGAAGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-477s1c1
Sequence:CCGGAGGTGTCTATGCAGGTTCCAACTCGAGTTGGAACCTGCATAGACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000096786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194059.1-220s1c1
Sequence:CCGGCGTGCCATCTATCAGTCCCATCTCGAGATGGGACTGATAGATGGCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)