EMAIL THIS PAGE TO A FRIEND

NANP

N-acetylneuraminic acid phosphatase

68 Gene Product Result for
Synonyms: C20orf147 HDHD4 dJ694B14.3
UniProtKB ID: Q8TBE9, B3KP12, Q5JYN8, Q8TE97, Q9Y3N0
Gene ID:
Mouse(67311) N-acetylneuraminic acid phosphatase
Rat(311530) N-acetylneuraminic acid phosphatase
Zebrafish(553795) N-acetylneuraminic acid phosphatase
chicken(421467) N-acetylneuraminic acid phosphatase
dog(608182) N-acetylneuraminic acid phosphatase
domestic cat(101092842) N-acetylneuraminic acid phosphatase
cow(516539) N-acetylneuraminic acid phosphatase
naked mole-rat(101714663) N-acetylneuraminic acid phosphatase
domestic guinea pig(100720176) N-acetylneuraminic acid phosphatase
sheep(101106351) N-acetylneuraminic acid phosphatase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026086 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026086 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026086 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152667 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152667 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152667 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152667 Rosetta Predictions human pricing
NM_001009409 Rosetta Predictions rat pricing
NM_026086 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152667 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058851 predicted 719
2 SASI_Hs01_00058852 predicted 228
3 SASI_Hs01_00058853 predicted 635
4 SASI_Hs02_00366557 predicted 253
5 SASI_Hs01_00058855 predicted 448
6 SASI_Hs01_00058856 predicted 372
7 SASI_Hs01_00058857 predicted 319
8 SASI_Hs01_00058858 predicted 550
9 SASI_Hs01_00058859 predicted 844
10 SASI_Hs01_00058860 predicted 213
11 SASI_Hs01_00058854 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009409 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059226 predicted 285
2 SASI_Rn01_00059227 predicted 451
3 SASI_Rn01_00059228 predicted 198
4 SASI_Rn01_00059229 predicted 586
5 SASI_Rn01_00059230 predicted 789
6 SASI_Rn01_00059232 predicted 306
7 SASI_Rn01_00059233 predicted 573
8 SASI_Rn01_00059234 predicted 568
9 SASI_Rn01_00059235 predicted 717
10 SASI_Rn02_00199530 predicted 620
11 SASI_Rn01_00059231 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026086 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149440 predicted 270
2 SASI_Mm01_00149441 predicted 207
3 SASI_Mm01_00149442 predicted 462
4 SASI_Mm01_00149443 predicted 608
5 SASI_Mm01_00149444 predicted 297
6 SASI_Mm01_00149445 predicted 205
7 SASI_Mm01_00149446 predicted 629
8 SASI_Mm01_00149447 predicted 308
9 SASI_Mm01_00149448 predicted 510
10 SASI_Mm01_00149449 predicted 318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026086
VALIDATED
NANP MISSION shRNA Bacterial Glycerol Stock
N-acetylneuraminic acid phosphatase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026086.1-719s1c1
Sequence:CCGGGCTAGAATTACCTGCTCTCTTCTCGAGAAGAGAGCAGGTAATTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026086.1-734s21c1
Sequence:CCGGTCTCTTGCAAAGCATAGATTGCTCGAGCAATCTATGCTTTGCAAGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026086.1-954s21c1
Sequence:CCGGTATCCGAAATCCAGGTATTAACTCGAGTTAATACCTGGATTTCGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026086.1-638s1c1
Sequence:CCGGGAAAGCTACGGTCTGGATAAACTCGAGTTTATCCAGACCGTAGCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026086.1-486s1c1
Sequence:CCGGGCCATTGTTATTGGCGGAGAACTCGAGTTCTCCGCCAATAACAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026086.1-107s21c1
Sequence:CCGGAGGCATGTTGGAGGTAATAAACTCGAGTTTATTACCTCCAACATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026086.1-687s21c1
Sequence:CCGGTCACCCATGCCTCACTATATGCTCGAGCATATAGTGAGGCATGGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026086
VALIDATED
NANP MISSION shRNA shRNA Plasmid DNA
N-acetylneuraminic acid phosphatase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026086.1-719s1c1
Sequence:CCGGGCTAGAATTACCTGCTCTCTTCTCGAGAAGAGAGCAGGTAATTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026086.1-734s21c1
Sequence:CCGGTCTCTTGCAAAGCATAGATTGCTCGAGCAATCTATGCTTTGCAAGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026086.1-954s21c1
Sequence:CCGGTATCCGAAATCCAGGTATTAACTCGAGTTAATACCTGGATTTCGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026086.1-638s1c1
Sequence:CCGGGAAAGCTACGGTCTGGATAAACTCGAGTTTATCCAGACCGTAGCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026086.1-486s1c1
Sequence:CCGGGCCATTGTTATTGGCGGAGAACTCGAGTTCTCCGCCAATAACAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026086.1-107s21c1
Sequence:CCGGAGGCATGTTGGAGGTAATAAACTCGAGTTTATTACCTCCAACATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026086.1-687s21c1
Sequence:CCGGTCACCCATGCCTCACTATATGCTCGAGCATATAGTGAGGCATGGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026086
VALIDATED
NANP MISSION shRNA Lentiviral Transduction Particles
N-acetylneuraminic acid phosphatase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026086.1-719s1c1
Sequence:CCGGGCTAGAATTACCTGCTCTCTTCTCGAGAAGAGAGCAGGTAATTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026086.1-734s21c1
Sequence:CCGGTCTCTTGCAAAGCATAGATTGCTCGAGCAATCTATGCTTTGCAAGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026086.1-954s21c1
Sequence:CCGGTATCCGAAATCCAGGTATTAACTCGAGTTAATACCTGGATTTCGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026086.1-638s1c1
Sequence:CCGGGAAAGCTACGGTCTGGATAAACTCGAGTTTATCCAGACCGTAGCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026086.1-486s1c1
Sequence:CCGGGCCATTGTTATTGGCGGAGAACTCGAGTTCTCCGCCAATAACAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026086.1-107s21c1
Sequence:CCGGAGGCATGTTGGAGGTAATAAACTCGAGTTTATTACCTCCAACATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026086.1-687s21c1
Sequence:CCGGTCACCCATGCCTCACTATATGCTCGAGCATATAGTGAGGCATGGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152667
VALIDATED
NANP MISSION shRNA Bacterial Glycerol Stock
N-acetylneuraminic acid phosphatase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152667.1-406s1c1
Sequence:CCGGCGCCTACTTCTATTAACGAATCTCGAGATTCGTTAATAGAAGTAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152667.1-324s1c1
Sequence:CCGGCCTTTGGAAATCTACACGTTTCTCGAGAAACGTGTAGATTTCCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152667.1-230s1c1
Sequence:CCGGGCATTACTGATTTAAGGACTTCTCGAGAAGTCCTTAAATCAGTAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152667.1-755s1c1
Sequence:CCGGGCAAAGTCAGTATGTCCACTTCTCGAGAAGTGGACATACTGACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152667.1-730s1c1
Sequence:CCGGCCTGCTCTCTTACAAAGTATACTCGAGTATACTTTGTAAGAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152667.2-1288s21c1
Sequence:CCGGACATGCAAATCAAGGTATTATCTCGAGATAATACCTTGATTTGCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152667.2-873s21c1
Sequence:CCGGAGTTAGGGCACTCCACTTATGCTCGAGCATAAGTGGAGTGCCCTAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152667.2-390s21c1
Sequence:CCGGCACTAGCAGAAGACGTCAAAGCTCGAGCTTTGACGTCTTCTGCTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152667
VALIDATED
NANP MISSION shRNA shRNA Plasmid DNA
N-acetylneuraminic acid phosphatase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152667.1-406s1c1
Sequence:CCGGCGCCTACTTCTATTAACGAATCTCGAGATTCGTTAATAGAAGTAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152667.1-324s1c1
Sequence:CCGGCCTTTGGAAATCTACACGTTTCTCGAGAAACGTGTAGATTTCCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152667.1-230s1c1
Sequence:CCGGGCATTACTGATTTAAGGACTTCTCGAGAAGTCCTTAAATCAGTAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152667.1-755s1c1
Sequence:CCGGGCAAAGTCAGTATGTCCACTTCTCGAGAAGTGGACATACTGACTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152667.1-730s1c1
Sequence:CCGGCCTGCTCTCTTACAAAGTATACTCGAGTATACTTTGTAAGAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152667.2-1288s21c1
Sequence:CCGGACATGCAAATCAAGGTATTATCTCGAGATAATACCTTGATTTGCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152667.2-873s21c1
Sequence:CCGGAGTTAGGGCACTCCACTTATGCTCGAGCATAAGTGGAGTGCCCTAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152667.2-390s21c1
Sequence:CCGGCACTAGCAGAAGACGTCAAAGCTCGAGCTTTGACGTCTTCTGCTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152667
VALIDATED
NANP MISSION shRNA Lentiviral Transduction Particles
N-acetylneuraminic acid phosphatase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152667.1-406s1c1
Sequence:CCGGCGCCTACTTCTATTAACGAATCTCGAGATTCGTTAATAGAAGTAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152667.1-324s1c1
Sequence:CCGGCCTTTGGAAATCTACACGTTTCTCGAGAAACGTGTAGATTTCCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_152667.1-230s1c1
Sequence:CCGGGCATTACTGATTTAAGGACTTCTCGAGAAGTCCTTAAATCAGTAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152667.1-755s1c1
Sequence:CCGGGCAAAGTCAGTATGTCCACTTCTCGAGAAGTGGACATACTGACTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_152667.1-730s1c1
Sequence:CCGGCCTGCTCTCTTACAAAGTATACTCGAGTATACTTTGTAAGAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430845    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152667.2-1288s21c1
Sequence:CCGGACATGCAAATCAAGGTATTATCTCGAGATAATACCTTGATTTGCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152667.2-873s21c1
Sequence:CCGGAGTTAGGGCACTCCACTTATGCTCGAGCATAAGTGGAGTGCCCTAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152667.2-390s21c1
Sequence:CCGGCACTAGCAGAAGACGTCAAAGCTCGAGCTTTGACGTCTTCTGCTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)