EMAIL THIS PAGE TO A FRIEND

NANS

N-acetylneuraminic acid synthase

47 Gene Product Result for
Synonyms: SAS
UniProtKB ID: Q9NR45, B2RE98, Q8WUV9, Q9BWS6, Q9NVD4
Gene ID:
Human(54187) Summary: This gene encodes an enzyme that functions in the biosynthetic pathways of sialic acids. In vitro, the encoded protein uses N-acetylmannosamine 6-phosphate and mannose 6-phosphate as substrates to generate phosphorylated forms of N-acetylneuraminic acid (Neu5Ac) and 2-keto-3-deoxy-D-glycero-D-galacto-nononic acid (KDN), respectively; however, it exhibits much higher activity toward the Neu5Ac phosphate product. In insect cells, expression of this gene results in Neu5Ac and KDN production. This gene is related to the E. coli sialic acid synthase gene neuB, and it can partially restore sialic acid synthase activity in an E. coli neuB-negative mutant. [provided by RefSeq, Jul 2008]
Mouse(94181) N-acetylneuraminic acid synthase (sialic acid synthase)
Rat(298071) N-acetylneuraminic acid synthase
sheep(101104048) N-acetylneuraminic acid synthase
domestic guinea pig(100716456) N-acetylneuraminic acid synthase
naked mole-rat(101721582) N-acetylneuraminic acid synthase
Domestic Rabbit(100356934) N-acetylneuraminic acid synthase
Zebrafish(322780) N-acetylneuraminic acid synthase
chicken(427283) N-acetylneuraminic acid synthase
domestic cat(101092303) N-acetylneuraminic acid synthase
cow(540602) N-acetylneuraminic acid synthase
Horse(100064126) N-acetylneuraminic acid synthase
dog(481624) N-acetylneuraminic acid synthase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053179 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053179 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053179 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018946 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018946 Rosetta Predictions human pricing
NM_001106655 Rosetta Predictions rat pricing
NM_053179 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070542 predicted 768
2 SASI_Hs01_00070543 predicted 559
3 SASI_Hs01_00070544 predicted 672
4 SASI_Hs02_00352409 predicted 460
5 SASI_Hs02_00352410 predicted 771
6 SASI_Hs01_00070547 predicted 713
7 SASI_Hs01_00070548 predicted 428
8 SASI_Hs01_00070550 predicted 909
9 SASI_Hs01_00070551 predicted 698
10 SASI_Hs02_00352411 predicted 239
11 SASI_Hs01_00070545 predicted 244
12 SASI_Hs01_00070546 predicted 464
13 SASI_Hs01_00070549 predicted 708
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221088 predicted 1385
2 SASI_Rn02_00221089 predicted 1402
3 SASI_Rn02_00221090 predicted 377
4 SASI_Rn02_00221091 predicted 334
5 SASI_Rn02_00221092 predicted 228
6 SASI_Rn02_00221093 predicted 274
7 SASI_Rn02_00221094 predicted 1312
8 SASI_Rn02_00221095 predicted 651
9 SASI_Rn02_00221096 predicted 466
10 SASI_Rn02_00221097 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053179 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088763 predicted 1404
2 SASI_Mm01_00088764 predicted 390
3 SASI_Mm01_00088765 predicted 1314
4 SASI_Mm02_00337736 predicted 726
5 SASI_Mm01_00088766 predicted 516
6 SASI_Mm01_00088767 predicted 376
7 SASI_Mm01_00088768 predicted 272
8 SASI_Mm01_00088769 predicted 1218
9 SASI_Mm01_00088770 predicted 669
10 SASI_Mm01_00088771 predicted 630
11 SASI_Mm01_00088772 predicted 874
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053179
VALIDATED
NANS MISSION shRNA Bacterial Glycerol Stock
N-acetylneuraminic acid synthase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-174s21c1
Sequence:CCGGCGACTGCGCTAAGTTTCAGAACTCGAGTTCTGAAACTTAGCGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-528s21c1
Sequence:CCGGGCAAGTCTATCAGATCGTGAACTCGAGTTCACGATCTGATAGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-1036s21c1
Sequence:CCGGCTGGTCACTATCGAAGAAGATCTCGAGATCTTCTTCGATAGTGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-382s21c1
Sequence:CCGGGCAGTTGAGTTTCTGCACGAACTCGAGTTCGTGCAGAAACTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-1336s1c1
Sequence:CCGGGTTGACATCTTCAGCCTTCAACTCGAGTTGAAGGCTGAAGATGTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-175s1c1
Sequence:CCGGCGACTGCGCTAAGTTTCAGAACTCGAGTTCTGAAACTTAGCGCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-383s1c1
Sequence:CCGGGCAGTTGAGTTTCTGCACGAACTCGAGTTCGTGCAGAAACTCAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-529s1c1
Sequence:CCGGGCAAGTCTATCAGATCGTGAACTCGAGTTCACGATCTGATAGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-1037s1c1
Sequence:CCGGCTGGTCACTATCGAAGAAGATCTCGAGATCTTCTTCGATAGTGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053179
VALIDATED
NANS MISSION shRNA shRNA Plasmid DNA
N-acetylneuraminic acid synthase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-174s21c1
Sequence:CCGGCGACTGCGCTAAGTTTCAGAACTCGAGTTCTGAAACTTAGCGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-528s21c1
Sequence:CCGGGCAAGTCTATCAGATCGTGAACTCGAGTTCACGATCTGATAGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-1036s21c1
Sequence:CCGGCTGGTCACTATCGAAGAAGATCTCGAGATCTTCTTCGATAGTGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-382s21c1
Sequence:CCGGGCAGTTGAGTTTCTGCACGAACTCGAGTTCGTGCAGAAACTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-1336s1c1
Sequence:CCGGGTTGACATCTTCAGCCTTCAACTCGAGTTGAAGGCTGAAGATGTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-175s1c1
Sequence:CCGGCGACTGCGCTAAGTTTCAGAACTCGAGTTCTGAAACTTAGCGCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-383s1c1
Sequence:CCGGGCAGTTGAGTTTCTGCACGAACTCGAGTTCGTGCAGAAACTCAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-529s1c1
Sequence:CCGGGCAAGTCTATCAGATCGTGAACTCGAGTTCACGATCTGATAGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-1037s1c1
Sequence:CCGGCTGGTCACTATCGAAGAAGATCTCGAGATCTTCTTCGATAGTGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053179
VALIDATED
NANS MISSION shRNA Lentiviral Transduction Particles
N-acetylneuraminic acid synthase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-174s21c1
Sequence:CCGGCGACTGCGCTAAGTTTCAGAACTCGAGTTCTGAAACTTAGCGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326009    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-528s21c1
Sequence:CCGGGCAAGTCTATCAGATCGTGAACTCGAGTTCACGATCTGATAGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-1036s21c1
Sequence:CCGGCTGGTCACTATCGAAGAAGATCTCGAGATCTTCTTCGATAGTGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053179.3-382s21c1
Sequence:CCGGGCAGTTGAGTTTCTGCACGAACTCGAGTTCGTGCAGAAACTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075928    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-1336s1c1
Sequence:CCGGGTTGACATCTTCAGCCTTCAACTCGAGTTGAAGGCTGAAGATGTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-175s1c1
Sequence:CCGGCGACTGCGCTAAGTTTCAGAACTCGAGTTCTGAAACTTAGCGCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-383s1c1
Sequence:CCGGGCAGTTGAGTTTCTGCACGAACTCGAGTTCGTGCAGAAACTCAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-529s1c1
Sequence:CCGGGCAAGTCTATCAGATCGTGAACTCGAGTTCACGATCTGATAGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053179.2-1037s1c1
Sequence:CCGGCTGGTCACTATCGAAGAAGATCTCGAGATCTTCTTCGATAGTGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018946
VALIDATED
NANS MISSION shRNA Bacterial Glycerol Stock
N-acetylneuraminic acid synthase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018946.3-499s21c1
Sequence:CCGGCATGAACTGAATGTTCCATTTCTCGAGAAATGGAACATTCAGTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018946.3-619s21c1
Sequence:CCGGGACACCATGAAGCAAGTTTATCTCGAGATAAACTTGCTTCATGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018946.3-1044s21c1
Sequence:CCGGCACCATTCTAACAATGGACATCTCGAGATGTCCATTGTTAGAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018946.3-780s21c1
Sequence:CCGGGCATGAAACAGGCATAGCGATCTCGAGATCGCTATGCCTGTTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-982s1c1
Sequence:CCGGCACCATTCTAACAATGGACATCTCGAGATGTCCATTGTTAGAATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-250s1c1
Sequence:CCGGCAAGTTTAATCGGAAAGCCTTCTCGAGAAGGCTTTCCGATTAAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-557s1c1
Sequence:CCGGGACACCATGAAGCAAGTTTATCTCGAGATAAACTTGCTTCATGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-718s1c1
Sequence:CCGGGCATGAAACAGGCATAGCGATCTCGAGATCGCTATGCCTGTTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018946.2-437s1c1
Sequence:CCGGCATGAACTGAATGTTCCATTTCTCGAGAAATGGAACATTCAGTTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018946
VALIDATED
NANS MISSION shRNA shRNA Plasmid DNA
N-acetylneuraminic acid synthase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018946.3-499s21c1
Sequence:CCGGCATGAACTGAATGTTCCATTTCTCGAGAAATGGAACATTCAGTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018946.3-619s21c1
Sequence:CCGGGACACCATGAAGCAAGTTTATCTCGAGATAAACTTGCTTCATGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018946.3-1044s21c1
Sequence:CCGGCACCATTCTAACAATGGACATCTCGAGATGTCCATTGTTAGAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018946.3-780s21c1
Sequence:CCGGGCATGAAACAGGCATAGCGATCTCGAGATCGCTATGCCTGTTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-982s1c1
Sequence:CCGGCACCATTCTAACAATGGACATCTCGAGATGTCCATTGTTAGAATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-250s1c1
Sequence:CCGGCAAGTTTAATCGGAAAGCCTTCTCGAGAAGGCTTTCCGATTAAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-557s1c1
Sequence:CCGGGACACCATGAAGCAAGTTTATCTCGAGATAAACTTGCTTCATGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-718s1c1
Sequence:CCGGGCATGAAACAGGCATAGCGATCTCGAGATCGCTATGCCTGTTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018946.2-437s1c1
Sequence:CCGGCATGAACTGAATGTTCCATTTCTCGAGAAATGGAACATTCAGTTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018946
VALIDATED
NANS MISSION shRNA Lentiviral Transduction Particles
N-acetylneuraminic acid synthase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018946.3-499s21c1
Sequence:CCGGCATGAACTGAATGTTCCATTTCTCGAGAAATGGAACATTCAGTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018946.3-619s21c1
Sequence:CCGGGACACCATGAAGCAAGTTTATCTCGAGATAAACTTGCTTCATGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018946.3-1044s21c1
Sequence:CCGGCACCATTCTAACAATGGACATCTCGAGATGTCCATTGTTAGAATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_018946.3-780s21c1
Sequence:CCGGGCATGAAACAGGCATAGCGATCTCGAGATCGCTATGCCTGTTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-982s1c1
Sequence:CCGGCACCATTCTAACAATGGACATCTCGAGATGTCCATTGTTAGAATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-250s1c1
Sequence:CCGGCAAGTTTAATCGGAAAGCCTTCTCGAGAAGGCTTTCCGATTAAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-557s1c1
Sequence:CCGGGACACCATGAAGCAAGTTTATCTCGAGATAAACTTGCTTCATGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018946.2-718s1c1
Sequence:CCGGGCATGAAACAGGCATAGCGATCTCGAGATCGCTATGCCTGTTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_018946.2-437s1c1
Sequence:CCGGCATGAACTGAATGTTCCATTTCTCGAGAAATGGAACATTCAGTTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)