EMAIL THIS PAGE TO A FRIEND

NAP1L1

nucleosome assembly protein 1-like 1

171 Gene Product Result for
Synonyms: NAP1 NAP1L NRP
UniProtKB ID: P55209
Gene ID:
Human(4673) Summary: This gene encodes a member of the nucleosome assembly protein (NAP) family. This protein participates in DNA replication and may play a role in modulating chromatin formation and contribute to the regulation of cell proliferation. Alternative splicing of this gene results in several transcript variants; however, not all have been fully described. [provided by RefSeq, Jul 2008]
Mouse(53605) nucleosome assembly protein 1-like 1
Rat(89825) nucleosome assembly protein 1-like 1
Zebrafish(368260) nucleosome assembly protein 1, like 1
Horse(100050241) nucleosome assembly protein 1-like 1
cow(282286) nucleosome assembly protein 1-like 1
cow(790872) nucleosome assembly protein 1-like 1
domestic cat(101083605) nucleosome assembly protein 1-like 1
chicken(417864) nucleosome assembly protein 1-like 1
dog(475407) nucleosome assembly protein 1-like 1
naked mole-rat(101708869) nucleosome assembly protein 1-like 1
domestic guinea pig(100715824) nucleosome assembly protein 1-like 1
sheep(101122264) nucleosome assembly protein 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0065 AQUA Peptide FYEEVHDLE[R] chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015781 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015781 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015781 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004537 Rosetta Predictions human pricing
NM_139207 Rosetta Predictions human pricing
NM_053561 Rosetta Predictions rat pricing
XM_579563 Rosetta Predictions rat pricing
NM_015781 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197387 predicted 666
2 SASI_Hs01_00197388 predicted 879
3 SASI_Hs01_00197389 predicted 659
4 SASI_Hs01_00197390 predicted 799
5 SASI_Hs01_00197391 predicted 764
6 SASI_Hs01_00197392 predicted 286
7 SASI_Hs01_00197393 predicted 544
8 SASI_Hs01_00197394 predicted 220
9 SASI_Hs01_00197395 predicted 707
10 SASI_Hs02_00337845 predicted 691
11 SASI_Hs01_00197386 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139207 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029349 predicted 663
2 SASI_Hs01_00029350 predicted 878
3 SASI_Hs01_00029351 predicted 660
4 SASI_Hs01_00029352 predicted 800
5 SASI_Hs01_00029353 predicted 770
6 SASI_Hs01_00029354 predicted 281
7 SASI_Hs01_00029355 predicted 543
8 SASI_Hs01_00029356 predicted 217
9 SASI_Hs01_00029357 predicted 713
10 SASI_Hs02_00364231 predicted 688
11 SASI_Hs01_00029348 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053561 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075274 predicted 328
2 SASI_Rn01_00075275 predicted 850
3 SASI_Rn01_00075276 predicted 521
4 SASI_Rn01_00075278 predicted 399
5 SASI_Rn01_00075279 predicted 820
6 SASI_Rn01_00075280 predicted 1372
7 SASI_Rn01_00075281 predicted 813
8 SASI_Rn01_00075282 predicted 1432
9 SASI_Rn01_00075283 predicted 647
10 SASI_Rn02_00266220 predicted 486
11 SASI_Rn01_00075277 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00187816 predicted 235
2 SASI_Rn01_00187817 predicted 316
3 SASI_Rn01_00187818 predicted 259
4 SASI_Rn01_00187819 predicted 230
5 SASI_Rn01_00187820 predicted 319
6 SASI_Rn01_00187821 predicted 327
7 SASI_Rn01_00187822 predicted 317
8 SASI_Rn01_00187823 predicted 369
9 SASI_Rn01_00187824 predicted 364
10 SASI_Rn01_00187825 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015781 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170276 predicted 839
2 SASI_Mm01_00170278 predicted 1443
3 SASI_Mm01_00170279 predicted 1886
4 SASI_Mm01_00170280 predicted 695
5 SASI_Mm01_00170281 predicted 1648
6 SASI_Mm01_00170282 predicted 1560
7 SASI_Mm01_00170283 predicted 781
8 SASI_Mm01_00170284 predicted 1701
9 SASI_Mm01_00170285 predicted 1683
10 SASI_Mm02_00323130 predicted 817
11 SASI_Mm01_00170277 predicted 1814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004537
VALIDATED
NAP1L1 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004537.3-572s1c1
Sequence:CCGGGCCAAGATTGAAGATGAGAAACTCGAGTTTCTCATCTTCAATCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004537.3-695s1c1
Sequence:CCGGCCTATTCTGAAGCACTTGAAACTCGAGTTTCAAGTGCTTCAGAATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004537.3-401s1c1
Sequence:CCGGGCCAAATTCTATGAGGAAGTTCTCGAGAACTTCCTCATAGAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004537.3-398s1c1
Sequence:CCGGGAAGCCAAATTCTATGAGGAACTCGAGTTCCTCATAGAATTTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-860s21c1
Sequence:CCGGGCCAAGATTGAAGATGAGAAACTCGAGTTTCTCATCTTCAATCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004537.4-1678s21c1
Sequence:CCGGTCTTGGTAGACTAGGTAATTTCTCGAGAAATTACCTAGTCTACCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-735s21c1
Sequence:CCGGTTCTCTATCAGCCTCTATTTGCTCGAGCAAATAGAGGCTGATAGAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-983s21c1
Sequence:CCGGCCTATTCTGAAGCACTTGAAACTCGAGTTTCAAGTGCTTCAGAATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-689s21c1
Sequence:CCGGGCCAAATTCTATGAGGAAGTTCTCGAGAACTTCCTCATAGAATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004537
VALIDATED
NAP1L1 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004537.3-572s1c1
Sequence:CCGGGCCAAGATTGAAGATGAGAAACTCGAGTTTCTCATCTTCAATCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004537.3-695s1c1
Sequence:CCGGCCTATTCTGAAGCACTTGAAACTCGAGTTTCAAGTGCTTCAGAATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004537.3-401s1c1
Sequence:CCGGGCCAAATTCTATGAGGAAGTTCTCGAGAACTTCCTCATAGAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004537.3-398s1c1
Sequence:CCGGGAAGCCAAATTCTATGAGGAACTCGAGTTCCTCATAGAATTTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-860s21c1
Sequence:CCGGGCCAAGATTGAAGATGAGAAACTCGAGTTTCTCATCTTCAATCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004537.4-1678s21c1
Sequence:CCGGTCTTGGTAGACTAGGTAATTTCTCGAGAAATTACCTAGTCTACCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-735s21c1
Sequence:CCGGTTCTCTATCAGCCTCTATTTGCTCGAGCAAATAGAGGCTGATAGAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-983s21c1
Sequence:CCGGCCTATTCTGAAGCACTTGAAACTCGAGTTTCAAGTGCTTCAGAATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-689s21c1
Sequence:CCGGGCCAAATTCTATGAGGAAGTTCTCGAGAACTTCCTCATAGAATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004537
VALIDATED
NAP1L1 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004537.3-572s1c1
Sequence:CCGGGCCAAGATTGAAGATGAGAAACTCGAGTTTCTCATCTTCAATCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004537.3-695s1c1
Sequence:CCGGCCTATTCTGAAGCACTTGAAACTCGAGTTTCAAGTGCTTCAGAATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004537.3-401s1c1
Sequence:CCGGGCCAAATTCTATGAGGAAGTTCTCGAGAACTTCCTCATAGAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004537.3-398s1c1
Sequence:CCGGGAAGCCAAATTCTATGAGGAACTCGAGTTCCTCATAGAATTTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-860s21c1
Sequence:CCGGGCCAAGATTGAAGATGAGAAACTCGAGTTTCTCATCTTCAATCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280610    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004537.4-1678s21c1
Sequence:CCGGTCTTGGTAGACTAGGTAATTTCTCGAGAAATTACCTAGTCTACCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-735s21c1
Sequence:CCGGTTCTCTATCAGCCTCTATTTGCTCGAGCAAATAGAGGCTGATAGAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-983s21c1
Sequence:CCGGCCTATTCTGAAGCACTTGAAACTCGAGTTTCAAGTGCTTCAGAATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004537.4-689s21c1
Sequence:CCGGGCCAAATTCTATGAGGAAGTTCTCGAGAACTTCCTCATAGAATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015781
VALIDATED
NAP1L1 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-1887s1c1
Sequence:CCGGGCCCTGTAATAGCCTAAACATCTCGAGATGTTTAGGCTATTACAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-1804s1c1
Sequence:CCGGCGATCCAGACTATGACCCAAACTCGAGTTTGGGTCATAGTCTGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-836s1c1
Sequence:CCGGGCTCTTCAGGAAAGACTTGATCTCGAGATCAAGTCTTTCCTGAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015781.2-1017s1c1
Sequence:CCGGAGCCTTTATTTGATAAGCGATCTCGAGATCGCTTATCAAATAAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-962s1c1
Sequence:CCGGGCCAAATTCTATGAGGAAGTTCTCGAGAACTTCCTCATAGAATTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-737s21c1
Sequence:CCGGAGGAACATGATGAACCTATTCCTCGAGGAATAGGTTCATCATGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-207s21c1
Sequence:CCGGGTCTGAACTTGATCAAGATTTCTCGAGAAATCTTGATCAAGTTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-536s21c1
Sequence:CCGGAGATCATTAATGCAATCTATGCTCGAGCATAGATTGCATTAATGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-759s21c1
Sequence:CCGGGAAGCACTTGAAAGATATTAACTCGAGTTAATATCTTTCAAGTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015781
VALIDATED
NAP1L1 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-1887s1c1
Sequence:CCGGGCCCTGTAATAGCCTAAACATCTCGAGATGTTTAGGCTATTACAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-1804s1c1
Sequence:CCGGCGATCCAGACTATGACCCAAACTCGAGTTTGGGTCATAGTCTGGATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-836s1c1
Sequence:CCGGGCTCTTCAGGAAAGACTTGATCTCGAGATCAAGTCTTTCCTGAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015781.2-1017s1c1
Sequence:CCGGAGCCTTTATTTGATAAGCGATCTCGAGATCGCTTATCAAATAAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-962s1c1
Sequence:CCGGGCCAAATTCTATGAGGAAGTTCTCGAGAACTTCCTCATAGAATTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-737s21c1
Sequence:CCGGAGGAACATGATGAACCTATTCCTCGAGGAATAGGTTCATCATGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-207s21c1
Sequence:CCGGGTCTGAACTTGATCAAGATTTCTCGAGAAATCTTGATCAAGTTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-536s21c1
Sequence:CCGGAGATCATTAATGCAATCTATGCTCGAGCATAGATTGCATTAATGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-759s21c1
Sequence:CCGGGAAGCACTTGAAAGATATTAACTCGAGTTAATATCTTTCAAGTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015781
VALIDATED
NAP1L1 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092888    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-1887s1c1
Sequence:CCGGGCCCTGTAATAGCCTAAACATCTCGAGATGTTTAGGCTATTACAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-1804s1c1
Sequence:CCGGCGATCCAGACTATGACCCAAACTCGAGTTTGGGTCATAGTCTGGATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-836s1c1
Sequence:CCGGGCTCTTCAGGAAAGACTTGATCTCGAGATCAAGTCTTTCCTGAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015781.2-1017s1c1
Sequence:CCGGAGCCTTTATTTGATAAGCGATCTCGAGATCGCTTATCAAATAAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015781.2-962s1c1
Sequence:CCGGGCCAAATTCTATGAGGAAGTTCTCGAGAACTTCCTCATAGAATTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-737s21c1
Sequence:CCGGAGGAACATGATGAACCTATTCCTCGAGGAATAGGTTCATCATGTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-207s21c1
Sequence:CCGGGTCTGAACTTGATCAAGATTTCTCGAGAAATCTTGATCAAGTTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-536s21c1
Sequence:CCGGAGATCATTAATGCAATCTATGCTCGAGCATAGATTGCATTAATGATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015781.4-759s21c1
Sequence:CCGGGAAGCACTTGAAAGATATTAACTCGAGTTAATATCTTTCAAGTGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)