EMAIL THIS PAGE TO A FRIEND

NAP1L2

nucleosome assembly protein 1-like 2

96 Gene Product Result for
Synonyms: BPX
UniProtKB ID: Q9ULW6, B2RE61, Q8TAN6
Gene ID:
Human(4674) Summary: The protein encoded by this intronless gene is a member of the nucleosome assembly protein (NAP) family. The encoded protein represents a class of tissue-specific factors that interact with chromatin to regulate neuronal cell proliferation. [provided by RefSeq, Jan 2011]
Mouse(17954) nucleosome assembly protein 1-like 2
Rat(317247) nucleosome assembly protein 1-like 2
dog(491959) nucleosome assembly protein 1-like 2
domestic cat(101097625) nucleosome assembly protein 1-like 2
sheep(101111521) nucleosome assembly protein 1-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008671 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008671 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008671 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021963 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU164411 MISSION® esiRNA esiRNA targeting mouse Nap1l2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021963 Rosetta Predictions human pricing
NM_001024789 Rosetta Predictions rat pricing
NM_008671 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126094 predicted 1535
2 SASI_Hs01_00126095 predicted 1770
3 SASI_Hs01_00126096 predicted 1263
4 SASI_Hs01_00126097 predicted 1717
5 SASI_Hs01_00126098 predicted 1250
6 SASI_Hs01_00126099 predicted 1678
7 SASI_Hs01_00126100 predicted 580
8 SASI_Hs01_00126101 predicted 1220
9 SASI_Hs02_00355305 predicted 1217
10 SASI_Hs01_00126103 predicted 1724
11 SASI_Hs01_00126102 predicted 1537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062451 predicted 1578
2 SASI_Rn01_00062452 predicted 713
3 SASI_Rn01_00062453 predicted 1446
4 SASI_Rn01_00062454 predicted 1693
5 SASI_Rn02_00202698 predicted 1647
6 SASI_Rn01_00062455 predicted 1119
7 SASI_Rn01_00062456 predicted 1109
8 SASI_Rn01_00062457 predicted 1279
9 SASI_Rn01_00062458 predicted 683
10 SASI_Rn01_00062459 predicted 1624
11 SASI_Rn01_00062450 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008671 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060564 predicted 1517
2 SASI_Mm01_00060565 predicted 1739
3 SASI_Mm01_00060566 predicted 1650
4 SASI_Mm01_00060567 predicted 1596
5 SASI_Mm01_00060568 predicted 928
6 SASI_Mm01_00060569 predicted 1190
7 SASI_Mm01_00060570 predicted 782
8 SASI_Mm01_00060571 predicted 791
9 SASI_Mm01_00060572 predicted 713
10 SASI_Mm01_00060573 predicted 1729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008671
VALIDATED
NAP1L2 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-1507s21c1
Sequence:CCGGGGTCATAATCTGCGTACTTACCTCGAGGTAAGTACGCAGATTATGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008671.1-1939s21c1
Sequence:CCGGTTGTGCCATGTATCTATTAATCTCGAGATTAATAGATACATGGCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-837s21c1
Sequence:CCGGATCGGACTGTGAGGACTATTTCTCGAGAAATAGTCCTCACAGTCCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-1177s21c1
Sequence:CCGGCTCAGCTTCACACTCGAATTTCTCGAGAAATTCGAGTGTGAAGCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-1596s21c1
Sequence:CCGGGGAAGTTAATGACGAAATATACTCGAGTATATTTCGTCATTAACTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008671.1-751s1c1
Sequence:CCGGGCTGAAATGTACCAACCCTTACTCGAGTAAGGGTTGGTACATTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008671.1-2108s1c1
Sequence:CCGGGCAGTAAATATGCAGTAGAATCTCGAGATTCTACTGCATATTTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008671.1-1645s1c1
Sequence:CCGGGCTGCAATTGAAGAGGTTAAACTCGAGTTTAACCTCTTCAATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008671.1-1404s1c1
Sequence:CCGGCCGAACTGTGACTGAAGATTTCTCGAGAAATCTTCAGTCACAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008671.1-1191s1c1
Sequence:CCGGCGAATTTCACTTCAAGCCCAACTCGAGTTGGGCTTGAAGTGAAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008671
VALIDATED
NAP1L2 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-1507s21c1
Sequence:CCGGGGTCATAATCTGCGTACTTACCTCGAGGTAAGTACGCAGATTATGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008671.1-1939s21c1
Sequence:CCGGTTGTGCCATGTATCTATTAATCTCGAGATTAATAGATACATGGCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-837s21c1
Sequence:CCGGATCGGACTGTGAGGACTATTTCTCGAGAAATAGTCCTCACAGTCCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-1177s21c1
Sequence:CCGGCTCAGCTTCACACTCGAATTTCTCGAGAAATTCGAGTGTGAAGCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000339967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-1596s21c1
Sequence:CCGGGGAAGTTAATGACGAAATATACTCGAGTATATTTCGTCATTAACTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008671.1-751s1c1
Sequence:CCGGGCTGAAATGTACCAACCCTTACTCGAGTAAGGGTTGGTACATTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008671.1-2108s1c1
Sequence:CCGGGCAGTAAATATGCAGTAGAATCTCGAGATTCTACTGCATATTTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008671.1-1645s1c1
Sequence:CCGGGCTGCAATTGAAGAGGTTAAACTCGAGTTTAACCTCTTCAATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008671.1-1404s1c1
Sequence:CCGGCCGAACTGTGACTGAAGATTTCTCGAGAAATCTTCAGTCACAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008671.1-1191s1c1
Sequence:CCGGCGAATTTCACTTCAAGCCCAACTCGAGTTGGGCTTGAAGTGAAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008671
VALIDATED
NAP1L2 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-1507s21c1
Sequence:CCGGGGTCATAATCTGCGTACTTACCTCGAGGTAAGTACGCAGATTATGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008671.1-1939s21c1
Sequence:CCGGTTGTGCCATGTATCTATTAATCTCGAGATTAATAGATACATGGCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-837s21c1
Sequence:CCGGATCGGACTGTGAGGACTATTTCTCGAGAAATAGTCCTCACAGTCCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-1177s21c1
Sequence:CCGGCTCAGCTTCACACTCGAATTTCTCGAGAAATTCGAGTGTGAAGCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000339967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008671.1-1596s21c1
Sequence:CCGGGGAAGTTAATGACGAAATATACTCGAGTATATTTCGTCATTAACTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008671.1-751s1c1
Sequence:CCGGGCTGAAATGTACCAACCCTTACTCGAGTAAGGGTTGGTACATTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008671.1-2108s1c1
Sequence:CCGGGCAGTAAATATGCAGTAGAATCTCGAGATTCTACTGCATATTTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008671.1-1645s1c1
Sequence:CCGGGCTGCAATTGAAGAGGTTAAACTCGAGTTTAACCTCTTCAATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008671.1-1404s1c1
Sequence:CCGGCCGAACTGTGACTGAAGATTTCTCGAGAAATCTTCAGTCACAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008671.1-1191s1c1
Sequence:CCGGCGAATTTCACTTCAAGCCCAACTCGAGTTGGGCTTGAAGTGAAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021963
VALIDATED
NAP1L2 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000146531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021963.2-720s1c1
Sequence:CCGGGCGGCCAATTTAGAATCCAAACTCGAGTTTGGATTCTAAATTGGCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021963.2-1967s1c1
Sequence:CCGGGCTTAATCCTTCTGAAGTCTTCTCGAGAAGACTTCAGAAGGATTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-660s1c1
Sequence:CCGGGAAAGTCTACCTGTGAAAGTTCTCGAGAACTTTCACAGGTAGACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-674s1c1
Sequence:CCGGGAAAGTTAAGTACCGTGTGTTCTCGAGAACACACGGTACTTAACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021963.2-1778s21c1
Sequence:CCGGTATAGTTACTCAAGGTATAAGCTCGAGCTTATACCTTGAGTAACTATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-1280s21c1
Sequence:GTACCGGGAAGTCAAAGCTAGCATATTACTCGAGTAATATGCTAGCTTTGACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-959s21c1
Sequence:CCGGTGGTTATGAGGACTATTATTACTCGAGTAATAATAGTCCTCATAACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-711s21c1
Sequence:CCGGCAAACTAGAGCGGCCAATTTACTCGAGTAAATTGGCCGCTCTAGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-1278s1c1
Sequence:CCGGCTGAAGTCAAAGCTAGCATATCTCGAGATATGCTAGCTTTGACTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-1430s1c1
Sequence:CCGGCCGAACTGTAACTGAAGATTTCTCGAGAAATCTTCAGTTACAGTTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-1533s21c1
Sequence:CCGGGGTCACAATTTACGTACTTACCTCGAGGTAAGTACGTAAATTGTGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021963
VALIDATED
NAP1L2 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000146531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021963.2-720s1c1
Sequence:CCGGGCGGCCAATTTAGAATCCAAACTCGAGTTTGGATTCTAAATTGGCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021963.2-1967s1c1
Sequence:CCGGGCTTAATCCTTCTGAAGTCTTCTCGAGAAGACTTCAGAAGGATTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-660s1c1
Sequence:CCGGGAAAGTCTACCTGTGAAAGTTCTCGAGAACTTTCACAGGTAGACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-674s1c1
Sequence:CCGGGAAAGTTAAGTACCGTGTGTTCTCGAGAACACACGGTACTTAACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021963.2-1778s21c1
Sequence:CCGGTATAGTTACTCAAGGTATAAGCTCGAGCTTATACCTTGAGTAACTATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-1280s21c1
Sequence:GTACCGGGAAGTCAAAGCTAGCATATTACTCGAGTAATATGCTAGCTTTGACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-959s21c1
Sequence:CCGGTGGTTATGAGGACTATTATTACTCGAGTAATAATAGTCCTCATAACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-711s21c1
Sequence:CCGGCAAACTAGAGCGGCCAATTTACTCGAGTAAATTGGCCGCTCTAGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-1278s1c1
Sequence:CCGGCTGAAGTCAAAGCTAGCATATCTCGAGATATGCTAGCTTTGACTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-1430s1c1
Sequence:CCGGCCGAACTGTAACTGAAGATTTCTCGAGAAATCTTCAGTTACAGTTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-1533s21c1
Sequence:CCGGGGTCACAATTTACGTACTTACCTCGAGGTAAGTACGTAAATTGTGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021963
VALIDATED
NAP1L2 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000146531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_021963.2-720s1c1
Sequence:CCGGGCGGCCAATTTAGAATCCAAACTCGAGTTTGGATTCTAAATTGGCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021963.2-1967s1c1
Sequence:CCGGGCTTAATCCTTCTGAAGTCTTCTCGAGAAGACTTCAGAAGGATTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-660s1c1
Sequence:CCGGGAAAGTCTACCTGTGAAAGTTCTCGAGAACTTTCACAGGTAGACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-674s1c1
Sequence:CCGGGAAAGTTAAGTACCGTGTGTTCTCGAGAACACACGGTACTTAACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021963.2-1778s21c1
Sequence:CCGGTATAGTTACTCAAGGTATAAGCTCGAGCTTATACCTTGAGTAACTATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-1280s21c1
Sequence:GTACCGGGAAGTCAAAGCTAGCATATTACTCGAGTAATATGCTAGCTTTGACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-959s21c1
Sequence:CCGGTGGTTATGAGGACTATTATTACTCGAGTAATAATAGTCCTCATAACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-711s21c1
Sequence:CCGGCAAACTAGAGCGGCCAATTTACTCGAGTAAATTGGCCGCTCTAGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-1278s1c1
Sequence:CCGGCTGAAGTCAAAGCTAGCATATCTCGAGATATGCTAGCTTTGACTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021963.2-1430s1c1
Sequence:CCGGCCGAACTGTAACTGAAGATTTCTCGAGAAATCTTCAGTTACAGTTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021963.2-1533s21c1
Sequence:CCGGGGTCACAATTTACGTACTTACCTCGAGGTAAGTACGTAAATTGTGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)