EMAIL THIS PAGE TO A FRIEND

NAP1L3

nucleosome assembly protein 1-like 3

66 Gene Product Result for
Synonyms: MB20 NPL3
UniProtKB ID: Q99457, B2RCM0, O60788
Gene ID:
Human(4675) Summary: This gene is intronless and encodes a member of the nucleosome assembly protein (NAP) family. This gene is linked closely to a region of genes responsible for several X-linked mental retardation syndromes. [provided by RefSeq, Dec 2010]
Mouse(54561) nucleosome assembly protein 1-like 3
Rat(170914) nucleosome assembly protein 1-like 3
Horse(100071669) nucleosome assembly protein 1-like 3
cow(788191) nucleosome assembly protein 1-like 3
dog(492003) nucleosome assembly protein 1-like 3
domestic cat(101100036) nucleosome assembly protein 1-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004538 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004538 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004538 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004538 Rosetta Predictions human pricing
NM_133402 Rosetta Predictions rat pricing
NM_138742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213263 predicted 1608
2 SASI_Hs01_00213264 predicted 731
3 SASI_Hs01_00213265 predicted 1218
4 SASI_Hs01_00213266 predicted 1005
5 SASI_Hs01_00213267 predicted 1130
6 SASI_Hs01_00213268 predicted 1237
7 SASI_Hs02_00337846 predicted 1493
8 SASI_Hs01_00213269 predicted 1193
9 SASI_Hs01_00213270 predicted 1763
10 SASI_Hs01_00213271 predicted 1095
11 SASI_Hs01_00213272 predicted 1923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089551 predicted 1844
2 SASI_Rn01_00089552 predicted 793
3 SASI_Rn01_00089553 predicted 1747
4 SASI_Rn01_00089554 predicted 1879
5 SASI_Rn02_00267660 predicted 814
6 SASI_Rn01_00089555 predicted 1955
7 SASI_Rn01_00089556 predicted 1320
8 SASI_Rn01_00089558 predicted 1890
9 SASI_Rn01_00089559 predicted 1784
10 SASI_Rn01_00089560 predicted 1943
11 SASI_Rn01_00089557 predicted 1831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041094 predicted 1405
2 SASI_Mm01_00041095 predicted 1865
3 SASI_Mm01_00041096 predicted 1344
4 SASI_Mm01_00041097 predicted 1971
5 SASI_Mm01_00041098 predicted 1777
6 SASI_Mm01_00041099 predicted 2049
7 SASI_Mm01_00041100 predicted 1980
8 SASI_Mm01_00041101 predicted 1811
9 SASI_Mm01_00041102 predicted 1846
10 SASI_Mm01_00041103 predicted 1598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004538
VALIDATED
NAP1L3 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-1073s1c1
Sequence:CCGGCCAGGTAAAGGCAGATGATAACTCGAGTTATCATCTGCCTTTACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-2119s1c1
Sequence:CCGGCCTTTGGTCATGTTTCTGTTACTCGAGTAACAGAAACATGACCAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-1361s1c1
Sequence:CCGGGCCTGTAAGTTACACCTTTGACTCGAGTCAAAGGTGTAACTTACAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-1131s1c1
Sequence:CCGGGCAGTAAGAGAGACTCATAAACTCGAGTTTATGAGTCTCTCTTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004538.3-612s1c1
Sequence:CCGGGCAGTTAGAAATCGTGTGCAACTCGAGTTGCACACGATTTCTAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004538.4-1316s21c1
Sequence:CCGGGAAGTTCTTGTCGGATGTTAGCTCGAGCTAACATCCGACAAGAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004538.4-742s21c1
Sequence:CCGGGGCGGTTTCAAATCATCAATGCTCGAGCATTGATGATTTGAAACCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004538.4-1913s21c1
Sequence:CCGGTGTAACCTGAACACTATTATTCTCGAGAATAATAGTGTTCAGGTTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004538.4-1732s21c1
Sequence:CCGGTCATCCTGAAATCAATCTATTCTCGAGAATAGATTGATTTCAGGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004538.4-2018s21c1
Sequence:CCGGTCTAGGCTGTTGTAGTATAATCTCGAGATTATACTACAACAGCCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004538
VALIDATED
NAP1L3 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-1073s1c1
Sequence:CCGGCCAGGTAAAGGCAGATGATAACTCGAGTTATCATCTGCCTTTACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-2119s1c1
Sequence:CCGGCCTTTGGTCATGTTTCTGTTACTCGAGTAACAGAAACATGACCAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-1361s1c1
Sequence:CCGGGCCTGTAAGTTACACCTTTGACTCGAGTCAAAGGTGTAACTTACAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-1131s1c1
Sequence:CCGGGCAGTAAGAGAGACTCATAAACTCGAGTTTATGAGTCTCTCTTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004538.3-612s1c1
Sequence:CCGGGCAGTTAGAAATCGTGTGCAACTCGAGTTGCACACGATTTCTAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004538.4-1316s21c1
Sequence:CCGGGAAGTTCTTGTCGGATGTTAGCTCGAGCTAACATCCGACAAGAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004538.4-742s21c1
Sequence:CCGGGGCGGTTTCAAATCATCAATGCTCGAGCATTGATGATTTGAAACCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004538.4-1913s21c1
Sequence:CCGGTGTAACCTGAACACTATTATTCTCGAGAATAATAGTGTTCAGGTTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004538.4-1732s21c1
Sequence:CCGGTCATCCTGAAATCAATCTATTCTCGAGAATAGATTGATTTCAGGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004538.4-2018s21c1
Sequence:CCGGTCTAGGCTGTTGTAGTATAATCTCGAGATTATACTACAACAGCCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004538
VALIDATED
NAP1L3 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-1073s1c1
Sequence:CCGGCCAGGTAAAGGCAGATGATAACTCGAGTTATCATCTGCCTTTACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-2119s1c1
Sequence:CCGGCCTTTGGTCATGTTTCTGTTACTCGAGTAACAGAAACATGACCAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-1361s1c1
Sequence:CCGGGCCTGTAAGTTACACCTTTGACTCGAGTCAAAGGTGTAACTTACAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004538.3-1131s1c1
Sequence:CCGGGCAGTAAGAGAGACTCATAAACTCGAGTTTATGAGTCTCTCTTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004538.3-612s1c1
Sequence:CCGGGCAGTTAGAAATCGTGTGCAACTCGAGTTGCACACGATTTCTAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004538.4-1316s21c1
Sequence:CCGGGAAGTTCTTGTCGGATGTTAGCTCGAGCTAACATCCGACAAGAACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004538.4-742s21c1
Sequence:CCGGGGCGGTTTCAAATCATCAATGCTCGAGCATTGATGATTTGAAACCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364163    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004538.4-1913s21c1
Sequence:CCGGTGTAACCTGAACACTATTATTCTCGAGAATAATAGTGTTCAGGTTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004538.4-1732s21c1
Sequence:CCGGTCATCCTGAAATCAATCTATTCTCGAGAATAGATTGATTTCAGGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378286    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004538.4-2018s21c1
Sequence:CCGGTCTAGGCTGTTGTAGTATAATCTCGAGATTATACTACAACAGCCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138742
NAP1L3 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138742.1-2104s1c1
Sequence:CCGGCCTGAACAGTATTACTCCTTACTCGAGTAAGGAGTAATACTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-822s1c1
Sequence:CCGGGCCTCTATATGATAAGCGTTTCTCGAGAAACGCTTATCATATAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-1532s1c1
Sequence:CCGGGCCAGCCTATTGGTTACACTTCTCGAGAAGTGTAACCAATAGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-1596s1c1
Sequence:CCGGCCTGATGAAGACATACATAATCTCGAGATTATGTATGTCTTCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-1858s1c1
Sequence:CCGGGCTATCCTTGATGAGGACTTTCTCGAGAAAGTCCTCATCAAGGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138742
NAP1L3 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138742.1-2104s1c1
Sequence:CCGGCCTGAACAGTATTACTCCTTACTCGAGTAAGGAGTAATACTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-822s1c1
Sequence:CCGGGCCTCTATATGATAAGCGTTTCTCGAGAAACGCTTATCATATAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-1532s1c1
Sequence:CCGGGCCAGCCTATTGGTTACACTTCTCGAGAAGTGTAACCAATAGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-1596s1c1
Sequence:CCGGCCTGATGAAGACATACATAATCTCGAGATTATGTATGTCTTCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-1858s1c1
Sequence:CCGGGCTATCCTTGATGAGGACTTTCTCGAGAAAGTCCTCATCAAGGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138742
NAP1L3 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138742.1-2104s1c1
Sequence:CCGGCCTGAACAGTATTACTCCTTACTCGAGTAAGGAGTAATACTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-822s1c1
Sequence:CCGGGCCTCTATATGATAAGCGTTTCTCGAGAAACGCTTATCATATAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-1532s1c1
Sequence:CCGGGCCAGCCTATTGGTTACACTTCTCGAGAAGTGTAACCAATAGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-1596s1c1
Sequence:CCGGCCTGATGAAGACATACATAATCTCGAGATTATGTATGTCTTCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138742.1-1858s1c1
Sequence:CCGGGCTATCCTTGATGAGGACTTTCTCGAGAAAGTCCTCATCAAGGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)