EMAIL THIS PAGE TO A FRIEND

NAP1L4

nucleosome assembly protein 1-like 4

53 Gene Product Result for
Synonyms: NAP1L4b NAP2 NAP2L hNAP2
UniProtKB ID: Q99733
Gene ID:
Human(4676) Summary: This gene encodes a member of the nucleosome assembly protein (NAP) family which can interact with both core and linker histones. It can shuttle between the cytoplasm and nucleus, suggesting a role as a histone chaperone. This gene is one of several located near the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. [provided by RefSeq, Jul 2008]
Mouse(17955) nucleosome assembly protein 1-like 4
Rat(361684) nucleosome assembly protein 1-like 4
chicken(423087) nucleosome assembly protein 1-like 4
cow(513028) nucleosome assembly protein 1-like 4
domestic cat(101089802) nucleosome assembly protein 1-like 4
dog(483670) nucleosome assembly protein 1-like 4
sheep(101102274) nucleosome assembly protein 1-like 4
domestic guinea pig(100733407) nucleosome assembly protein 1-like 4
naked mole-rat(101698498) nucleosome assembly protein 1-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0065 AQUA Peptide FYEEVHDLE[R] chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008672 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008672 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008672 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005969 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU067811 MISSION® esiRNA esiRNA targeting mouse Nap1l4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005969 Rosetta Predictions human pricing
NM_001012170 Rosetta Predictions rat pricing
XM_574590 Rosetta Predictions rat pricing
NM_008672 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131968 predicted 694
2 SASI_Hs01_00131969 predicted 370
3 SASI_Hs01_00131970 predicted 832
4 SASI_Hs01_00131971 predicted 809
5 SASI_Hs02_00340649 predicted 852
6 SASI_Hs01_00131972 predicted 431
7 SASI_Hs01_00131973 predicted 482
8 SASI_Hs02_00340650 predicted 304
9 SASI_Hs01_00131974 predicted 950
10 SASI_Hs01_00131975 predicted 362
11 SASI_Hs01_00131976 predicted 355
12 SASI_Hs01_00131977 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012170 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121098 predicted 339
2 SASI_Rn01_00121099 predicted 259
3 SASI_Rn01_00121100 predicted 210
4 SASI_Rn01_00121101 predicted 256
5 SASI_Rn01_00121102 predicted 404
6 SASI_Rn01_00121103 predicted 391
7 SASI_Rn02_00200367 predicted 779
8 SASI_Rn01_00121104 predicted 393
9 SASI_Rn01_00121105 predicted 306
10 SASI_Rn01_00121106 predicted 760
11 SASI_Rn01_00121107 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00162335 predicted 315
2 SASI_Rn01_00162336 predicted 638
3 SASI_Rn01_00162337 predicted 569
4 SASI_Rn01_00162338 predicted 772
5 SASI_Rn01_00162339 predicted 387
6 SASI_Rn01_00162340 predicted 368
7 SASI_Rn01_00162341 predicted 1463
8 SASI_Rn01_00162342 predicted 558
9 SASI_Rn01_00162343 predicted 290
10 SASI_Rn01_00162344 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008672 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314436 predicted 295
2 SASI_Mm02_00314437 predicted 1127
3 SASI_Mm02_00314438 predicted 1199
4 SASI_Mm02_00314439 predicted 967
5 SASI_Mm02_00314440 predicted 989
6 SASI_Mm02_00314441 predicted 727
7 SASI_Mm02_00314442 predicted 219
8 SASI_Mm02_00314443 predicted 450
9 SASI_Mm02_00314444 predicted 223
10 SASI_Mm02_00314445 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008672
VALIDATED
NAP1L4 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-700s21c1
Sequence:CCGGCCCAACGACTACTTCACCAATCTCGAGATTGGTGAAGTAGTCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-1449s21c1
Sequence:CCGGGCAGTTCAGAATAGGAGATTACTCGAGTAATCTCCTATTCTGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-181s21c1
Sequence:CCGGGCAGCTTTGCAGGAACGTCTTCTCGAGAAGACGTTCCTGCAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-181s1c1
Sequence:CCGGGCAGCTTTGCAGGAACGTCTTCTCGAGAAGACGTTCCTGCAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-1083s21c1
Sequence:CCGGCATAGAGGATGATGACAATTTCTCGAGAAATTGTCATCATCCTCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-1161s21c1
Sequence:CCGGTGAGGATGATGCTGATGTTAACTCGAGTTAACATCAGCATCATCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-355s1c1
Sequence:CCGGGCCTTGTACCAGCCTCTATTTCTCGAGAAATAGAGGCTGGTACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-1446s1c1
Sequence:CCGGGCAGTTCAGAATAGGAGATTACTCGAGTAATCTCCTATTCTGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-700s1c1
Sequence:CCGGCCCAACGACTACTTCACCAATCTCGAGATTGGTGAAGTAGTCGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008672.1-790s1c1
Sequence:CCGGCCTGAAATTGTGGACTGTGATCTCGAGATCACAGTCCACAATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008672
VALIDATED
NAP1L4 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-700s21c1
Sequence:CCGGCCCAACGACTACTTCACCAATCTCGAGATTGGTGAAGTAGTCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-1449s21c1
Sequence:CCGGGCAGTTCAGAATAGGAGATTACTCGAGTAATCTCCTATTCTGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-181s21c1
Sequence:CCGGGCAGCTTTGCAGGAACGTCTTCTCGAGAAGACGTTCCTGCAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-181s1c1
Sequence:CCGGGCAGCTTTGCAGGAACGTCTTCTCGAGAAGACGTTCCTGCAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-1083s21c1
Sequence:CCGGCATAGAGGATGATGACAATTTCTCGAGAAATTGTCATCATCCTCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-1161s21c1
Sequence:CCGGTGAGGATGATGCTGATGTTAACTCGAGTTAACATCAGCATCATCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-355s1c1
Sequence:CCGGGCCTTGTACCAGCCTCTATTTCTCGAGAAATAGAGGCTGGTACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-1446s1c1
Sequence:CCGGGCAGTTCAGAATAGGAGATTACTCGAGTAATCTCCTATTCTGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-700s1c1
Sequence:CCGGCCCAACGACTACTTCACCAATCTCGAGATTGGTGAAGTAGTCGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008672.1-790s1c1
Sequence:CCGGCCTGAAATTGTGGACTGTGATCTCGAGATCACAGTCCACAATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008672
VALIDATED
NAP1L4 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309400    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-700s21c1
Sequence:CCGGCCCAACGACTACTTCACCAATCTCGAGATTGGTGAAGTAGTCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309401    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-1449s21c1
Sequence:CCGGGCAGTTCAGAATAGGAGATTACTCGAGTAATCTCCTATTCTGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-181s21c1
Sequence:CCGGGCAGCTTTGCAGGAACGTCTTCTCGAGAAGACGTTCCTGCAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-181s1c1
Sequence:CCGGGCAGCTTTGCAGGAACGTCTTCTCGAGAAGACGTTCCTGCAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-1083s21c1
Sequence:CCGGCATAGAGGATGATGACAATTTCTCGAGAAATTGTCATCATCCTCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008672.2-1161s21c1
Sequence:CCGGTGAGGATGATGCTGATGTTAACTCGAGTTAACATCAGCATCATCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-355s1c1
Sequence:CCGGGCCTTGTACCAGCCTCTATTTCTCGAGAAATAGAGGCTGGTACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-1446s1c1
Sequence:CCGGGCAGTTCAGAATAGGAGATTACTCGAGTAATCTCCTATTCTGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008672.1-700s1c1
Sequence:CCGGCCCAACGACTACTTCACCAATCTCGAGATTGGTGAAGTAGTCGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008672.1-790s1c1
Sequence:CCGGCCTGAAATTGTGGACTGTGATCTCGAGATCACAGTCCACAATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005969
VALIDATED
NAP1L4 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005969.3-649s21c1
Sequence:CCGGGTGGACATGCTGAGTGAATTACTCGAGTAATTCACTCAGCATGTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005969.3-1235s21c1
Sequence:CCGGACGAGGATGATGCGGAAATTACTCGAGTAATTTCCGCATCATCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005969.3-1945s21c1
Sequence:CCGGGCTGCGGGTCACCTCATATTTCTCGAGAAATATGAGGTGACCCGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005969.3-770s21c1
Sequence:CCGGTTGAACCCAACGACTACTTTACTCGAGTAAAGTAGTCGTTGGGTTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005969.2-1156s1c1
Sequence:CCGGGCCATAGAAGATGATGACAATCTCGAGATTGTCATCATCTTCTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-657s1c1
Sequence:CCGGGCTGAGTGAATTAGTCCAGGACTCGAGTCCTGGACTAATTCACTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-885s1c1
Sequence:CCGGCGGGTGTACTATTGACTGGAACTCGAGTTCCAGTCAATAGTACACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005969.3-418s21c1
Sequence:CCGGAGAAAGTATGCAGCGCTATACCTCGAGGTATAGCGCTGCATACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-499s1c1
Sequence:CCGGGAATCGGAATGGCACAGTGAACTCGAGTTCACTGTGCCATTCCGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-1052s1c1
Sequence:CCGGCACTGGATGAAGATTCTGAATCTCGAGATTCAGAATCTTCATCCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-302s1c1
Sequence:CCGGGCTACATCGAAACTTTACCTACTCGAGTAGGTAAAGTTTCGATGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005969.2-178s1c1
Sequence:CCGGGATTCCGTGGAAGCTGCTAAACTCGAGTTTAGCAGCTTCCACGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005969
VALIDATED
NAP1L4 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005969.3-649s21c1
Sequence:CCGGGTGGACATGCTGAGTGAATTACTCGAGTAATTCACTCAGCATGTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005969.3-1235s21c1
Sequence:CCGGACGAGGATGATGCGGAAATTACTCGAGTAATTTCCGCATCATCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005969.3-1945s21c1
Sequence:CCGGGCTGCGGGTCACCTCATATTTCTCGAGAAATATGAGGTGACCCGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005969.3-770s21c1
Sequence:CCGGTTGAACCCAACGACTACTTTACTCGAGTAAAGTAGTCGTTGGGTTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005969.2-1156s1c1
Sequence:CCGGGCCATAGAAGATGATGACAATCTCGAGATTGTCATCATCTTCTATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-657s1c1
Sequence:CCGGGCTGAGTGAATTAGTCCAGGACTCGAGTCCTGGACTAATTCACTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-885s1c1
Sequence:CCGGCGGGTGTACTATTGACTGGAACTCGAGTTCCAGTCAATAGTACACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005969.3-418s21c1
Sequence:CCGGAGAAAGTATGCAGCGCTATACCTCGAGGTATAGCGCTGCATACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-499s1c1
Sequence:CCGGGAATCGGAATGGCACAGTGAACTCGAGTTCACTGTGCCATTCCGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-1052s1c1
Sequence:CCGGCACTGGATGAAGATTCTGAATCTCGAGATTCAGAATCTTCATCCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-302s1c1
Sequence:CCGGGCTACATCGAAACTTTACCTACTCGAGTAGGTAAAGTTTCGATGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005969.2-178s1c1
Sequence:CCGGGATTCCGTGGAAGCTGCTAAACTCGAGTTTAGCAGCTTCCACGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005969
VALIDATED
NAP1L4 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005969.3-649s21c1
Sequence:CCGGGTGGACATGCTGAGTGAATTACTCGAGTAATTCACTCAGCATGTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005969.3-1235s21c1
Sequence:CCGGACGAGGATGATGCGGAAATTACTCGAGTAATTTCCGCATCATCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244828    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005969.3-1945s21c1
Sequence:CCGGGCTGCGGGTCACCTCATATTTCTCGAGAAATATGAGGTGACCCGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005969.3-770s21c1
Sequence:CCGGTTGAACCCAACGACTACTTTACTCGAGTAAAGTAGTCGTTGGGTTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005969.2-1156s1c1
Sequence:CCGGGCCATAGAAGATGATGACAATCTCGAGATTGTCATCATCTTCTATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-657s1c1
Sequence:CCGGGCTGAGTGAATTAGTCCAGGACTCGAGTCCTGGACTAATTCACTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-885s1c1
Sequence:CCGGCGGGTGTACTATTGACTGGAACTCGAGTTCCAGTCAATAGTACACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005969.3-418s21c1
Sequence:CCGGAGAAAGTATGCAGCGCTATACCTCGAGGTATAGCGCTGCATACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-499s1c1
Sequence:CCGGGAATCGGAATGGCACAGTGAACTCGAGTTCACTGTGCCATTCCGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-1052s1c1
Sequence:CCGGCACTGGATGAAGATTCTGAATCTCGAGATTCAGAATCTTCATCCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005969.2-302s1c1
Sequence:CCGGGCTACATCGAAACTTTACCTACTCGAGTAGGTAAAGTTTCGATGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005969.2-178s1c1
Sequence:CCGGGATTCCGTGGAAGCTGCTAAACTCGAGTTTAGCAGCTTCCACGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)