EMAIL THIS PAGE TO A FRIEND

NAP1L5

nucleosome assembly protein 1-like 5

118 Gene Product Result for
Synonyms: DRLM
UniProtKB ID: Q96NT1
Gene ID:
Mouse(58243) nucleosome assembly protein 1-like 5
Rat(688843) nucleosome assembly protein 1-like 5
cow(508508) nucleosome assembly protein 1-like 5
dog(607931) nucleosome assembly protein 1-like 5
naked mole-rat(101726384) nucleosome assembly protein 1-like 5
sheep(101118873) nucleosome assembly protein 1-like 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153757 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153757 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153757 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153757 Rosetta Predictions human pricing
NM_001044293 Rosetta Predictions rat pricing
NM_021432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153757 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086940 predicted 883
2 SASI_Hs01_00086941 predicted 1002
3 SASI_Hs01_00086942 predicted 907
4 SASI_Hs01_00086943 predicted 954
5 SASI_Hs01_00086944 predicted 1005
6 SASI_Hs01_00086945 predicted 966
7 SASI_Hs01_00086946 predicted 988
8 SASI_Hs01_00086947 predicted 967
9 SASI_Hs01_00086948 predicted 959
10 SASI_Hs01_00086949 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00205604 predicted 1006
2 SASI_Rn02_00205605 predicted 853
3 SASI_Rn02_00205606 predicted 753
4 SASI_Rn02_00205607 predicted 841
5 SASI_Rn02_00205608 predicted 858
6 SASI_Rn02_00205609 predicted 261
7 SASI_Rn02_00205610 predicted 675
8 SASI_Rn02_00205611 predicted 353
9 SASI_Rn02_00205612 predicted 613
10 SASI_Rn02_00205613 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165948 predicted 1056
2 SASI_Mm01_00165944 predicted 1090
3 SASI_Mm01_00165945 predicted 882
4 SASI_Mm01_00165946 predicted 907
5 SASI_Mm01_00165947 predicted 993
6 SASI_Mm01_00165949 predicted 892
7 SASI_Mm01_00165950 predicted 976
8 SASI_Mm02_00326075 predicted 674
9 SASI_Mm01_00165952 predicted 720
10 SASI_Mm01_00165953 predicted 723
11 SASI_Mm01_00165951 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021432
NAP1L5 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-343s1c1
Sequence:CCGGAGGCCAAGTTTGACAAGGAATCTCGAGATTCCTTGTCAAACTTGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021432.1-717s1c1
Sequence:CCGGGCCCGTTTCTAATCTGACTTTCTCGAGAAAGTCAGATTAGAAACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-333s1c1
Sequence:CCGGGATAAGATCGAGGCCAAGTTTCTCGAGAAACTTGGCCTCGATCTTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-138s1c1
Sequence:CCGGGCCGAGGACGAGGTAATGGAACTCGAGTTCCATTACCTCGTCCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-273s1c1
Sequence:CCGGAGCTTGCCCAATTCCGTGAAACTCGAGTTTCACGGAATTGGGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-615s21c1
Sequence:CCGGCTTCGCCAAGAAGTGAGCACACTCGAGTGTGCTCACTTCTTGGCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-380s21c1
Sequence:CCGGTGCAGAAGCGCTGCGATAAGACTCGAGTCTTATCGCAGCGCTTCTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-435s21c1
Sequence:CCGGGGAGAAGAAGTACAACGATATCTCGAGATATCGTTGTACTTCTTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021432.2-1294s21c1
Sequence:CCGGTCTGTTATGGTCCCGTGTTACCTCGAGGTAACACGGGACCATAACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-345s21c1
Sequence:CCGGTTCCGTGAAATGCCGGGTTCTCTCGAGAGAACCCGGCATTTCACGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021432
NAP1L5 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-343s1c1
Sequence:CCGGAGGCCAAGTTTGACAAGGAATCTCGAGATTCCTTGTCAAACTTGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021432.1-717s1c1
Sequence:CCGGGCCCGTTTCTAATCTGACTTTCTCGAGAAAGTCAGATTAGAAACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-333s1c1
Sequence:CCGGGATAAGATCGAGGCCAAGTTTCTCGAGAAACTTGGCCTCGATCTTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-138s1c1
Sequence:CCGGGCCGAGGACGAGGTAATGGAACTCGAGTTCCATTACCTCGTCCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000092962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-273s1c1
Sequence:CCGGAGCTTGCCCAATTCCGTGAAACTCGAGTTTCACGGAATTGGGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-615s21c1
Sequence:CCGGCTTCGCCAAGAAGTGAGCACACTCGAGTGTGCTCACTTCTTGGCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-380s21c1
Sequence:CCGGTGCAGAAGCGCTGCGATAAGACTCGAGTCTTATCGCAGCGCTTCTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-435s21c1
Sequence:CCGGGGAGAAGAAGTACAACGATATCTCGAGATATCGTTGTACTTCTTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021432.2-1294s21c1
Sequence:CCGGTCTGTTATGGTCCCGTGTTACCTCGAGGTAACACGGGACCATAACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-345s21c1
Sequence:CCGGTTCCGTGAAATGCCGGGTTCTCTCGAGAGAACCCGGCATTTCACGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021432
NAP1L5 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-343s1c1
Sequence:CCGGAGGCCAAGTTTGACAAGGAATCTCGAGATTCCTTGTCAAACTTGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021432.1-717s1c1
Sequence:CCGGGCCCGTTTCTAATCTGACTTTCTCGAGAAAGTCAGATTAGAAACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-333s1c1
Sequence:CCGGGATAAGATCGAGGCCAAGTTTCTCGAGAAACTTGGCCTCGATCTTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-138s1c1
Sequence:CCGGGCCGAGGACGAGGTAATGGAACTCGAGTTCCATTACCTCGTCCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000092962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021432.1-273s1c1
Sequence:CCGGAGCTTGCCCAATTCCGTGAAACTCGAGTTTCACGGAATTGGGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-615s21c1
Sequence:CCGGCTTCGCCAAGAAGTGAGCACACTCGAGTGTGCTCACTTCTTGGCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-380s21c1
Sequence:CCGGTGCAGAAGCGCTGCGATAAGACTCGAGTCTTATCGCAGCGCTTCTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-435s21c1
Sequence:CCGGGGAGAAGAAGTACAACGATATCTCGAGATATCGTTGTACTTCTTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021432.2-1294s21c1
Sequence:CCGGTCTGTTATGGTCCCGTGTTACCTCGAGGTAACACGGGACCATAACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021432.2-345s21c1
Sequence:CCGGTTCCGTGAAATGCCGGGTTCTCTCGAGAGAACCCGGCATTTCACGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153757
NAP1L5 MISSION shRNA Bacterial Glycerol Stock
nucleosome assembly protein 1-like 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153757.2-828s21c1
Sequence:CCGGCCTGGCCAGCTCGATTCAAATCTCGAGATTTGAATCGAGCTGGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153757.1-339s1c1
Sequence:CCGGGAAGCGATGCGATAAGATAGACTCGAGTCTATCTTATCGCATCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153757.1-347s1c1
Sequence:CCGGGCGATAAGATAGAAGCCAAATCTCGAGATTTGGCTTCTATCTTATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153757.2-333s21c1
Sequence:CCGGGCCTGCCTAATTCGGTGAAATCTCGAGATTTCACCGAATTAGGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153757.2-1051s21c1
Sequence:CCGGACACGTTCTCAGTGCTTAATTCTCGAGAATTAAGCACTGAGAACGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153757.1-337s1c1
Sequence:CCGGCAGAAGCGATGCGATAAGATACTCGAGTATCTTATCGCATCGCTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153757.1-930s1c1
Sequence:CCGGGCGAAGTAAAGAACGTCACTTCTCGAGAAGTGACGTTCTTTACTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153757.1-931s1c1
Sequence:CCGGCGAAGTAAAGAACGTCACTTTCTCGAGAAAGTGACGTTCTTTACTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153757.1-630s1c1
Sequence:CCGGGCAGAGATGGATGAAGAGAAACTCGAGTTTCTCTTCATCCATCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153757
NAP1L5 MISSION shRNA shRNA Plasmid DNA
nucleosome assembly protein 1-like 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153757.2-828s21c1
Sequence:CCGGCCTGGCCAGCTCGATTCAAATCTCGAGATTTGAATCGAGCTGGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153757.1-339s1c1
Sequence:CCGGGAAGCGATGCGATAAGATAGACTCGAGTCTATCTTATCGCATCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153757.1-347s1c1
Sequence:CCGGGCGATAAGATAGAAGCCAAATCTCGAGATTTGGCTTCTATCTTATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153757.2-333s21c1
Sequence:CCGGGCCTGCCTAATTCGGTGAAATCTCGAGATTTCACCGAATTAGGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153757.2-1051s21c1
Sequence:CCGGACACGTTCTCAGTGCTTAATTCTCGAGAATTAAGCACTGAGAACGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153757.1-337s1c1
Sequence:CCGGCAGAAGCGATGCGATAAGATACTCGAGTATCTTATCGCATCGCTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153757.1-930s1c1
Sequence:CCGGGCGAAGTAAAGAACGTCACTTCTCGAGAAGTGACGTTCTTTACTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153757.1-931s1c1
Sequence:CCGGCGAAGTAAAGAACGTCACTTTCTCGAGAAAGTGACGTTCTTTACTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153757.1-630s1c1
Sequence:CCGGGCAGAGATGGATGAAGAGAAACTCGAGTTTCTCTTCATCCATCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153757
NAP1L5 MISSION shRNA Lentiviral Transduction Particles
nucleosome assembly protein 1-like 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358725    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153757.2-828s21c1
Sequence:CCGGCCTGGCCAGCTCGATTCAAATCTCGAGATTTGAATCGAGCTGGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153757.1-339s1c1
Sequence:CCGGGAAGCGATGCGATAAGATAGACTCGAGTCTATCTTATCGCATCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153757.1-347s1c1
Sequence:CCGGGCGATAAGATAGAAGCCAAATCTCGAGATTTGGCTTCTATCTTATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153757.2-333s21c1
Sequence:CCGGGCCTGCCTAATTCGGTGAAATCTCGAGATTTCACCGAATTAGGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153757.2-1051s21c1
Sequence:CCGGACACGTTCTCAGTGCTTAATTCTCGAGAATTAAGCACTGAGAACGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153757.1-337s1c1
Sequence:CCGGCAGAAGCGATGCGATAAGATACTCGAGTATCTTATCGCATCGCTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149015    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153757.1-930s1c1
Sequence:CCGGGCGAAGTAAAGAACGTCACTTCTCGAGAAGTGACGTTCTTTACTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146749    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153757.1-931s1c1
Sequence:CCGGCGAAGTAAAGAACGTCACTTTCTCGAGAAAGTGACGTTCTTTACTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149121    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153757.1-630s1c1
Sequence:CCGGGCAGAGATGGATGAAGAGAAACTCGAGTTTCTCTTCATCCATCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)