EMAIL THIS PAGE TO A FRIEND

NAPA

N-ethylmaleimide-sensitive factor attachment protein, alpha

57 Gene Product Result for
Synonyms: SNAPA
UniProtKB ID: P54920, A8K879, Q96IK3, Q9BVJ3
Gene ID:
Human(8775) Summary: This gene encodes a member of the soluble NSF attachment protein (SNAP) family. SNAP proteins play a critical role in the docking and fusion of vesicles to target membranes as part of the 20S NSF-SNAP-SNARE complex. The encoded protein plays a role in the completion of membrane fusion by mediating the interaction of N-ethylmaleimide-sensitive factor (NSF) with the vesicle-associated and membrane-associated SNAP receptor (SNARE) complex, and stimulating the ATPase activity of NSF. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2011]
Mouse(108124) N-ethylmaleimide sensitive fusion protein attachment protein alpha
Rat(140673) N-ethylmaleimide-sensitive factor attachment protein, alpha
Zebrafish(327082) N-ethylmaleimide sensitive fusion protein attachment protein alpha
domestic cat(101088535) N-ethylmaleimide-sensitive factor attachment protein, alpha
cow(782742) N-ethylmaleimide-sensitive factor attachment protein, alpha-like
dog(612960) N-ethylmaleimide-sensitive factor attachment protein, alpha
cow(518407) N-ethylmaleimide-sensitive factor attachment protein, alpha
domestic guinea pig(100719667) N-ethylmaleimide-sensitive factor attachment protein, alpha
naked mole-rat(101708063) N-ethylmaleimide-sensitive factor attachment protein, alpha
sheep(101119072) N-ethylmaleimide-sensitive factor attachment protein, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
S9319 Anti-α/β-SNAP (140-157) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, human, mouse
western blot pricing
S9444 Anti-α/β-SNAP, C-terminus (195-214) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
microarray, western blot pricing
AV13049 Anti-NAPA antibody produced in rabbit IgG fraction of antiserum canine, bovine, zebrafish, mouse
western blot pricing
HPA046149 Anti-NAPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA050196 Anti-NAPA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
S9447 Monoclonal Anti-α-SNAP antibody produced in mouse ~1 mg/mL, clone 4E4, purified immunoglobulin, buffered aqueous glycerol solution bovine, rat, human
immunoprecipitation (IP), western blot pricing
S9197 Monoclonal Anti-α-SNAP antibody produced in mouse ~1 mg/mL, clone 15D4, purified immunoglobulin, buffered aqueous glycerol solution human, bovine, rat
immunoprecipitation (IP), western blot pricing
S9322 Monoclonal Anti-α/β-SNAP antibody produced in mouse ~1 mg/mL, clone 16D1, purified immunoglobulin, buffered aqueous solution rat, bovine, human, chicken
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003827 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025898 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025898 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025898 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003827 Rosetta Predictions human pricing
NM_080585 Rosetta Predictions rat pricing
NM_025898 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205635 predicted 689
2 SASI_Hs01_00205638 predicted 1129
3 SASI_Hs01_00205639 predicted 763
4 SASI_Hs02_00336379 predicted 1099
5 SASI_Hs01_00205640 predicted 390
6 SASI_Hs02_00336380 predicted 558
7 SASI_Hs01_00205641 predicted 836
8 SASI_Hs01_00205642 predicted 667
9 SASI_Hs02_00336381 predicted 699
10 SASI_Hs01_00205644 predicted 615
11 SASI_Hs01_00205636 predicted 991
12 SASI_Hs01_00205637 predicted 1013
13 SASI_Hs01_00205643 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085145 predicted 481
2 SASI_Rn02_00267259 predicted 350
3 SASI_Rn01_00085146 predicted 461
4 SASI_Rn01_00085147 predicted 517
5 SASI_Rn02_00267260 predicted 361
6 SASI_Rn01_00085148 predicted 485
7 SASI_Rn01_00085149 predicted 440
8 SASI_Rn01_00085151 predicted 273
9 SASI_Rn01_00085153 predicted 406
10 SASI_Rn01_00085154 predicted 464
11 SASI_Rn01_00085150 predicted 507
12 SASI_Rn01_00085152 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025898 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076401 predicted 1208
2 SASI_Mm01_00076402 predicted 467
3 SASI_Mm01_00076403 predicted 322
4 SASI_Mm01_00076404 predicted 344
5 SASI_Mm02_00329249 predicted 471
6 SASI_Mm01_00076405 predicted 997
7 SASI_Mm01_00076406 predicted 422
8 SASI_Mm01_00076407 predicted 426
9 SASI_Mm01_00076408 predicted 462
10 SASI_Mm01_00076409 predicted 881
11 SASI_Mm01_00076410 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003827
VALIDATED
NAPA MISSION shRNA Bacterial Glycerol Stock
N-ethylmaleimide-sensitive factor attachment protein, alpha
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003827.2-1371s21c1
Sequence:GTACCGGCACCCTCTGTTCTCGCTACATCTCGAGATGTAGCGAGAACAGAGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003827.2-638s21c1
Sequence:GTACCGGACATGGGCCGATTCACGATTGCTCGAGCAATCGTGAATCGGCCCATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003827.2-614s21c1
Sequence:GTACCGGTGCGAGCAATCGAGATCTACACTCGAGTGTAGATCTCGATTGCTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003827.2-592s21c1
Sequence:GTACCGGCAAGAGGCCATTAACTGTTTGCTCGAGCAAACAGTTAATGGCCTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-831s21c1
Sequence:CCGGGTATCAGAAGGCCATTGACATCTCGAGATGTCAATGGCCTTCTGATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-1461s21c1
Sequence:CCGGTCTTTGATACAGACCTATTTGCTCGAGCAAATAGGTCTGTATCAAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-412s21c1
Sequence:CCGGATAGAGGAAGCATGCGAAATCCTCGAGGATTTCGCATGCTTCCTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-1014s21c1
Sequence:CCGGCCGGGAATGCAAGTTGATGAACTCGAGTTCATCAACTTGCATTCCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-900s21c1
Sequence:CCGGCAGCGCCAAAGACTACTTCTTCTCGAGAAGAAGTAGTCTTTGGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003827.2-1539s21c1
Sequence:GTACCGGTGAGTCATGAGGCCGGTTTCTCTCGAGAGAAACCGGCCTCATGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003827.1-781s1c1
Sequence:CCGGCCGGGAATGCAAGTTGATGAACTCGAGTTCATCAACTTGCATTCCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003827.1-667s1c1
Sequence:CCGGCAGCGCCAAAGACTACTTCTTCTCGAGAAGAAGTAGTCTTTGGCGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003827.1-329s1c1
Sequence:CCGGGCTGGCAACGCATTCAAGAAACTCGAGTTTCTTGAATGCGTTGCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003827.1-598s1c1
Sequence:CCGGGTATCAGAAGGCCATTGACATCTCGAGATGTCAATGGCCTTCTGATACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003827.1-153s1c1
Sequence:CCGGCTGGCCTCTTTGGAGGCTCATCTCGAGATGAGCCTCCAAAGAGGCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003827
VALIDATED
NAPA MISSION shRNA shRNA Plasmid DNA
N-ethylmaleimide-sensitive factor attachment protein, alpha
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003827.2-1371s21c1
Sequence:GTACCGGCACCCTCTGTTCTCGCTACATCTCGAGATGTAGCGAGAACAGAGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003827.2-638s21c1
Sequence:GTACCGGACATGGGCCGATTCACGATTGCTCGAGCAATCGTGAATCGGCCCATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003827.2-614s21c1
Sequence:GTACCGGTGCGAGCAATCGAGATCTACACTCGAGTGTAGATCTCGATTGCTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003827.2-592s21c1
Sequence:GTACCGGCAAGAGGCCATTAACTGTTTGCTCGAGCAAACAGTTAATGGCCTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-831s21c1
Sequence:CCGGGTATCAGAAGGCCATTGACATCTCGAGATGTCAATGGCCTTCTGATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-1461s21c1
Sequence:CCGGTCTTTGATACAGACCTATTTGCTCGAGCAAATAGGTCTGTATCAAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-412s21c1
Sequence:CCGGATAGAGGAAGCATGCGAAATCCTCGAGGATTTCGCATGCTTCCTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-1014s21c1
Sequence:CCGGCCGGGAATGCAAGTTGATGAACTCGAGTTCATCAACTTGCATTCCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-900s21c1
Sequence:CCGGCAGCGCCAAAGACTACTTCTTCTCGAGAAGAAGTAGTCTTTGGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003827.2-1539s21c1
Sequence:GTACCGGTGAGTCATGAGGCCGGTTTCTCTCGAGAGAAACCGGCCTCATGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003827.1-781s1c1
Sequence:CCGGCCGGGAATGCAAGTTGATGAACTCGAGTTCATCAACTTGCATTCCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003827.1-667s1c1
Sequence:CCGGCAGCGCCAAAGACTACTTCTTCTCGAGAAGAAGTAGTCTTTGGCGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003827.1-329s1c1
Sequence:CCGGGCTGGCAACGCATTCAAGAAACTCGAGTTTCTTGAATGCGTTGCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003827.1-598s1c1
Sequence:CCGGGTATCAGAAGGCCATTGACATCTCGAGATGTCAATGGCCTTCTGATACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003827.1-153s1c1
Sequence:CCGGCTGGCCTCTTTGGAGGCTCATCTCGAGATGAGCCTCCAAAGAGGCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003827
VALIDATED
NAPA MISSION shRNA Lentiviral Transduction Particles
N-ethylmaleimide-sensitive factor attachment protein, alpha
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382210    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003827.2-1371s21c1
Sequence:GTACCGGCACCCTCTGTTCTCGCTACATCTCGAGATGTAGCGAGAACAGAGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003827.2-638s21c1
Sequence:GTACCGGACATGGGCCGATTCACGATTGCTCGAGCAATCGTGAATCGGCCCATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003827.2-614s21c1
Sequence:GTACCGGTGCGAGCAATCGAGATCTACACTCGAGTGTAGATCTCGATTGCTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003827.2-592s21c1
Sequence:GTACCGGCAAGAGGCCATTAACTGTTTGCTCGAGCAAACAGTTAATGGCCTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-831s21c1
Sequence:CCGGGTATCAGAAGGCCATTGACATCTCGAGATGTCAATGGCCTTCTGATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-1461s21c1
Sequence:CCGGTCTTTGATACAGACCTATTTGCTCGAGCAAATAGGTCTGTATCAAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-412s21c1
Sequence:CCGGATAGAGGAAGCATGCGAAATCCTCGAGGATTTCGCATGCTTCCTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-1014s21c1
Sequence:CCGGCCGGGAATGCAAGTTGATGAACTCGAGTTCATCAACTTGCATTCCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003827.2-900s21c1
Sequence:CCGGCAGCGCCAAAGACTACTTCTTCTCGAGAAGAAGTAGTCTTTGGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003827.2-1539s21c1
Sequence:GTACCGGTGAGTCATGAGGCCGGTTTCTCTCGAGAGAAACCGGCCTCATGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_003827.1-781s1c1
Sequence:CCGGCCGGGAATGCAAGTTGATGAACTCGAGTTCATCAACTTGCATTCCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_003827.1-667s1c1
Sequence:CCGGCAGCGCCAAAGACTACTTCTTCTCGAGAAGAAGTAGTCTTTGGCGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003827.1-329s1c1
Sequence:CCGGGCTGGCAACGCATTCAAGAAACTCGAGTTTCTTGAATGCGTTGCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003827.1-598s1c1
Sequence:CCGGGTATCAGAAGGCCATTGACATCTCGAGATGTCAATGGCCTTCTGATACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003827.1-153s1c1
Sequence:CCGGCTGGCCTCTTTGGAGGCTCATCTCGAGATGAGCCTCCAAAGAGGCCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025898
VALIDATED
NAPA MISSION shRNA Bacterial Glycerol Stock
N-ethylmaleimide-sensitive factor attachment protein, alpha
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-479s21c1
Sequence:CCGGGCAGACTACTACAAAGGAGAACTCGAGTTCTCCTTTGTAGTAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-348s21c1
Sequence:CCGGTGAGAGCAATTGAGATCTATACTCGAGTATAGATCTCAATTGCTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-1069s21c1
Sequence:CCGGCCTTCACCCTGCCGTTTATTTCTCGAGAAATAAACGGCAGGGTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-150s21c1
Sequence:CCGGAGGAAGCATGCGAGATCTATGCTCGAGCATAGATCTCGCATGCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-637s21c1
Sequence:CCGGCGCCAAAGACTACTTCTTCAACTCGAGTTGAAGAAGTAGTCTTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025898.3-866s21c1
Sequence:GTACCGGACCATGCTTCTGCGCATAAAGCTCGAGCTTTATGCGCAGAAGCATGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025898.3-1196s21c1
Sequence:GTACCGGCCTGACCAGCAGTGTACTAAGCTCGAGCTTAGTACACTGCTGGTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025898.3-699s21c1
Sequence:GTACCGGAGCTCGCTGTTCAGAAGTATGCTCGAGCATACTTCTGAACAGCGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025898.1-1929s1c1
Sequence:CCGGGCTTCCTAAGTGGCTCAGATACTCGAGTATCTGAGCCACTTAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-297s1c1
Sequence:CCGGCGCTGGCAATGCTTTCAAGAACTCGAGTTCTTGAAAGCATTGCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-639s1c1
Sequence:CCGGCGCCAAAGACTACTTCTTCAACTCGAGTTGAAGAAGTAGTCTTTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-879s1c1
Sequence:CCGGGCGCATAAAGAAGACCATTCACTCGAGTGAATGGTCTTCTTTATGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-481s1c1
Sequence:CCGGGCAGACTACTACAAAGGAGAACTCGAGTTCTCCTTTGTAGTAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025898
VALIDATED
NAPA MISSION shRNA shRNA Plasmid DNA
N-ethylmaleimide-sensitive factor attachment protein, alpha
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-479s21c1
Sequence:CCGGGCAGACTACTACAAAGGAGAACTCGAGTTCTCCTTTGTAGTAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-348s21c1
Sequence:CCGGTGAGAGCAATTGAGATCTATACTCGAGTATAGATCTCAATTGCTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-1069s21c1
Sequence:CCGGCCTTCACCCTGCCGTTTATTTCTCGAGAAATAAACGGCAGGGTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-150s21c1
Sequence:CCGGAGGAAGCATGCGAGATCTATGCTCGAGCATAGATCTCGCATGCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-637s21c1
Sequence:CCGGCGCCAAAGACTACTTCTTCAACTCGAGTTGAAGAAGTAGTCTTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025898.3-866s21c1
Sequence:GTACCGGACCATGCTTCTGCGCATAAAGCTCGAGCTTTATGCGCAGAAGCATGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025898.3-1196s21c1
Sequence:GTACCGGCCTGACCAGCAGTGTACTAAGCTCGAGCTTAGTACACTGCTGGTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025898.3-699s21c1
Sequence:GTACCGGAGCTCGCTGTTCAGAAGTATGCTCGAGCATACTTCTGAACAGCGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025898.1-1929s1c1
Sequence:CCGGGCTTCCTAAGTGGCTCAGATACTCGAGTATCTGAGCCACTTAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-297s1c1
Sequence:CCGGCGCTGGCAATGCTTTCAAGAACTCGAGTTCTTGAAAGCATTGCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-639s1c1
Sequence:CCGGCGCCAAAGACTACTTCTTCAACTCGAGTTGAAGAAGTAGTCTTTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-879s1c1
Sequence:CCGGGCGCATAAAGAAGACCATTCACTCGAGTGAATGGTCTTCTTTATGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-481s1c1
Sequence:CCGGGCAGACTACTACAAAGGAGAACTCGAGTTCTCCTTTGTAGTAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025898
VALIDATED
NAPA MISSION shRNA Lentiviral Transduction Particles
N-ethylmaleimide-sensitive factor attachment protein, alpha
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-479s21c1
Sequence:CCGGGCAGACTACTACAAAGGAGAACTCGAGTTCTCCTTTGTAGTAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-348s21c1
Sequence:CCGGTGAGAGCAATTGAGATCTATACTCGAGTATAGATCTCAATTGCTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295240    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-1069s21c1
Sequence:CCGGCCTTCACCCTGCCGTTTATTTCTCGAGAAATAAACGGCAGGGTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-150s21c1
Sequence:CCGGAGGAAGCATGCGAGATCTATGCTCGAGCATAGATCTCGCATGCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025898.3-637s21c1
Sequence:CCGGCGCCAAAGACTACTTCTTCAACTCGAGTTGAAGAAGTAGTCTTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025898.3-866s21c1
Sequence:GTACCGGACCATGCTTCTGCGCATAAAGCTCGAGCTTTATGCGCAGAAGCATGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025898.3-1196s21c1
Sequence:GTACCGGCCTGACCAGCAGTGTACTAAGCTCGAGCTTAGTACACTGCTGGTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025898.3-699s21c1
Sequence:GTACCGGAGCTCGCTGTTCAGAAGTATGCTCGAGCATACTTCTGAACAGCGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111540    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025898.1-1929s1c1
Sequence:CCGGGCTTCCTAAGTGGCTCAGATACTCGAGTATCTGAGCCACTTAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-297s1c1
Sequence:CCGGCGCTGGCAATGCTTTCAAGAACTCGAGTTCTTGAAAGCATTGCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-639s1c1
Sequence:CCGGCGCCAAAGACTACTTCTTCAACTCGAGTTGAAGAAGTAGTCTTTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-879s1c1
Sequence:CCGGGCGCATAAAGAAGACCATTCACTCGAGTGAATGGTCTTCTTTATGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025898.1-481s1c1
Sequence:CCGGGCAGACTACTACAAAGGAGAACTCGAGTTCTCCTTTGTAGTAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)