EMAIL THIS PAGE TO A FRIEND

NAPB

N-ethylmaleimide-sensitive factor attachment protein, beta

57 Gene Product Result for
Synonyms: SNAP-BETA SNAPB
UniProtKB ID: Q9H115, Q4G187, Q5JXF9, Q8N3C4
Gene ID:
Mouse(17957) N-ethylmaleimide sensitive fusion protein attachment protein beta
Rat(499903) N-ethylmaleimide-sensitive factor attachment protein, beta
chicken(421231) N-ethylmaleimide-sensitive factor attachment protein, beta
domestic cat(101086134) N-ethylmaleimide-sensitive factor attachment protein, beta
cow(517728) N-ethylmaleimide-sensitive factor attachment protein, beta
dog(477131) N-ethylmaleimide-sensitive factor attachment protein, beta
sheep(101103338) N-ethylmaleimide-sensitive factor attachment protein, beta
naked mole-rat(101702834) N-ethylmaleimide-sensitive factor attachment protein, beta
domestic guinea pig(100717962) N-ethylmaleimide-sensitive factor attachment protein, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022080 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022080 Rosetta Predictions human pricing
XM_001057340 Rosetta Predictions rat pricing
XM_575249 Rosetta Predictions rat pricing
NM_019632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170145 predicted 1009
2 SASI_Hs01_00170146 predicted 437
3 SASI_Hs01_00170148 predicted 507
4 SASI_Hs01_00170149 predicted 425
5 SASI_Hs02_00355454 predicted 835
6 SASI_Hs01_00170150 predicted 616
7 SASI_Hs01_00170152 predicted 998
8 SASI_Hs01_00170153 predicted 642
9 SASI_Hs01_00170154 predicted 448
10 SASI_Hs02_00355455 predicted 811
11 SASI_Hs01_00170147 predicted 480
12 SASI_Hs01_00170151 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057340 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286087 predicted 644
2 SASI_Rn02_00286088 predicted 612
3 SASI_Rn02_00286089 predicted 598
4 SASI_Rn02_00286090 predicted 711
5 SASI_Rn02_00286091 predicted 289
6 SASI_Rn02_00286092 predicted 585
7 SASI_Rn02_00286093 predicted 269
8 SASI_Rn02_00286094 predicted 647
9 SASI_Rn02_00286095 predicted 783
10 SASI_Rn02_00286096 predicted 839
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575249 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403360 predicted 640
2 SASI_Rn02_00403361 predicted 613
3 SASI_Rn02_00403362 predicted 590
4 SASI_Rn02_00403363 predicted 713
5 SASI_Rn02_00403364 predicted 286
6 SASI_Rn02_00403365 predicted 589
7 SASI_Rn02_00403366 predicted 264
8 SASI_Rn02_00403367 predicted 642
9 SASI_Rn02_00403368 predicted 786
10 SASI_Rn02_00403369 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025530 predicted 489
2 SASI_Mm02_00324663 predicted 820
3 SASI_Mm01_00025531 predicted 886
4 SASI_Mm01_00025533 predicted 588
5 SASI_Mm01_00025535 predicted 469
6 SASI_Mm01_00025536 predicted 483
7 SASI_Mm02_00324664 predicted 314
8 SASI_Mm01_00025537 predicted 475
9 SASI_Mm01_00025538 predicted 519
10 SASI_Mm01_00025539 predicted 638
11 SASI_Mm01_00025532 predicted 749
12 SASI_Mm01_00025534 predicted 747
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019632
VALIDATED
NAPB MISSION shRNA Bacterial Glycerol Stock
N-ethylmaleimide-sensitive factor attachment protein, beta
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019632.3-1333s21c1
Sequence:CCGGACTTAGTTTAGGGTGCTTATTCTCGAGAATAAGCACCCTAAACTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019632.1-765s1c1
Sequence:CCGGCGGACTCCAGAGAATGTAAATCTCGAGATTTACATTCTCTGGAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019632.1-2911s1c1
Sequence:CCGGCCAGGGTTAAAGTCCCAGAATCTCGAGATTCTGGGACTTTAACCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019632.1-898s1c1
Sequence:CCGGGCTTCGTATCAAGAAGTCCATCTCGAGATGGACTTCTTGATACGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019632.1-320s1c1
Sequence:CCGGGCTGGAAATGCGTACAAGAAACTCGAGTTTCTTGTACGCATTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019632.1-463s1c1
Sequence:CCGGCGTGGACATTGAGAAGGCTATCTCGAGATAGCCTTCTCAATGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-431s21c1
Sequence:CCGGTCACCATTGCCGAGATCTATGCTCGAGCATAGATCTCGGCAATGGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019632.3-1079s21c1
Sequence:CCGGTGAGAATCGGAGGCTTCTATTCTCGAGAATAGAAGCCTCCGATTCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-462s21c1
Sequence:CCGGCGTGGACATTGAGAAGGCTATCTCGAGATAGCCTTCTCAATGTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-844s21c1
Sequence:CCGGGTGAAGGAGTTTGACTCAATACTCGAGTATTGAGTCAAACTCCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-352s21c1
Sequence:CCGGGAGGCTATCAACTGCTTAAATCTCGAGATTTAAGCAGTTGATAGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-763s21c1
Sequence:CCGGACGGACTCCAGAGAATGTAAACTCGAGTTTACATTCTCTGGAGTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019632.3-1399s21c1
Sequence:CCGGTAGCTACTTTGAAGGTGTTAGCTCGAGCTAACACCTTCAAAGTAGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019632
VALIDATED
NAPB MISSION shRNA shRNA Plasmid DNA
N-ethylmaleimide-sensitive factor attachment protein, beta
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019632.3-1333s21c1
Sequence:CCGGACTTAGTTTAGGGTGCTTATTCTCGAGAATAAGCACCCTAAACTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019632.1-765s1c1
Sequence:CCGGCGGACTCCAGAGAATGTAAATCTCGAGATTTACATTCTCTGGAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019632.1-2911s1c1
Sequence:CCGGCCAGGGTTAAAGTCCCAGAATCTCGAGATTCTGGGACTTTAACCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019632.1-898s1c1
Sequence:CCGGGCTTCGTATCAAGAAGTCCATCTCGAGATGGACTTCTTGATACGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019632.1-320s1c1
Sequence:CCGGGCTGGAAATGCGTACAAGAAACTCGAGTTTCTTGTACGCATTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019632.1-463s1c1
Sequence:CCGGCGTGGACATTGAGAAGGCTATCTCGAGATAGCCTTCTCAATGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-431s21c1
Sequence:CCGGTCACCATTGCCGAGATCTATGCTCGAGCATAGATCTCGGCAATGGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019632.3-1079s21c1
Sequence:CCGGTGAGAATCGGAGGCTTCTATTCTCGAGAATAGAAGCCTCCGATTCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-462s21c1
Sequence:CCGGCGTGGACATTGAGAAGGCTATCTCGAGATAGCCTTCTCAATGTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-844s21c1
Sequence:CCGGGTGAAGGAGTTTGACTCAATACTCGAGTATTGAGTCAAACTCCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-352s21c1
Sequence:CCGGGAGGCTATCAACTGCTTAAATCTCGAGATTTAAGCAGTTGATAGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-763s21c1
Sequence:CCGGACGGACTCCAGAGAATGTAAACTCGAGTTTACATTCTCTGGAGTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019632.3-1399s21c1
Sequence:CCGGTAGCTACTTTGAAGGTGTTAGCTCGAGCTAACACCTTCAAAGTAGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019632
VALIDATED
NAPB MISSION shRNA Lentiviral Transduction Particles
N-ethylmaleimide-sensitive factor attachment protein, beta
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019632.3-1333s21c1
Sequence:CCGGACTTAGTTTAGGGTGCTTATTCTCGAGAATAAGCACCCTAAACTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019632.1-765s1c1
Sequence:CCGGCGGACTCCAGAGAATGTAAATCTCGAGATTTACATTCTCTGGAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111635    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019632.1-2911s1c1
Sequence:CCGGCCAGGGTTAAAGTCCCAGAATCTCGAGATTCTGGGACTTTAACCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019632.1-898s1c1
Sequence:CCGGGCTTCGTATCAAGAAGTCCATCTCGAGATGGACTTCTTGATACGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019632.1-320s1c1
Sequence:CCGGGCTGGAAATGCGTACAAGAAACTCGAGTTTCTTGTACGCATTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019632.1-463s1c1
Sequence:CCGGCGTGGACATTGAGAAGGCTATCTCGAGATAGCCTTCTCAATGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-431s21c1
Sequence:CCGGTCACCATTGCCGAGATCTATGCTCGAGCATAGATCTCGGCAATGGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379757    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019632.3-1079s21c1
Sequence:CCGGTGAGAATCGGAGGCTTCTATTCTCGAGAATAGAAGCCTCCGATTCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-462s21c1
Sequence:CCGGCGTGGACATTGAGAAGGCTATCTCGAGATAGCCTTCTCAATGTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-844s21c1
Sequence:CCGGGTGAAGGAGTTTGACTCAATACTCGAGTATTGAGTCAAACTCCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-352s21c1
Sequence:CCGGGAGGCTATCAACTGCTTAAATCTCGAGATTTAAGCAGTTGATAGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019632.3-763s21c1
Sequence:CCGGACGGACTCCAGAGAATGTAAACTCGAGTTTACATTCTCTGGAGTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375832    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019632.3-1399s21c1
Sequence:CCGGTAGCTACTTTGAAGGTGTTAGCTCGAGCTAACACCTTCAAAGTAGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022080
NAPB MISSION shRNA Bacterial Glycerol Stock
N-ethylmaleimide-sensitive factor attachment protein, beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-829s1c1
Sequence:CCGGGTGAAGGAATTTGACTCAATACTCGAGTATTGAGTCAAATTCCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-411s1c1
Sequence:CCGGCCACATTACTATTGCAGAGATCTCGAGATCTCTGCAATAGTAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-646s1c1
Sequence:CCGGGCAAAGGATTACTTCTTCAAACTCGAGTTTGAAGAAGTAATCCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-487s1c1
Sequence:CCGGGCTGATTATTACAAAGGAGAACTCGAGTTCTCCTTTGTAATAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-712s1c1
Sequence:CCGGGCTCTTGAGAAATATGAGGAACTCGAGTTCCTCATATTTCTCAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022080.2-2152s21c1
Sequence:CCGGTCATGAACTTGATCCTATTAACTCGAGTTAATAGGATCAAGTTCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022080.1-1189s21c1
Sequence:CCGGAGAATCTCATCCCTCATATTTCTCGAGAAATATGAGGGATGAGATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-578s21c1
Sequence:GTACCGGAGAAAGCCATTGAGATCTATGCTCGAGCATAGATCTCAATGGCTTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-338s21c1
Sequence:CCGGAGGCTATCAACTGCTTAAATGCTCGAGCATTTAAGCAGTTGATAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-403s21c1
Sequence:CCGGGCCAAGCACCACATTACTATTCTCGAGAATAGTAATGTGGTGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-476s21c1
Sequence:CCGGATGAACAATCTGCTGATTATTCTCGAGAATAATCAGCAGATTGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022080
NAPB MISSION shRNA shRNA Plasmid DNA
N-ethylmaleimide-sensitive factor attachment protein, beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-829s1c1
Sequence:CCGGGTGAAGGAATTTGACTCAATACTCGAGTATTGAGTCAAATTCCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-411s1c1
Sequence:CCGGCCACATTACTATTGCAGAGATCTCGAGATCTCTGCAATAGTAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-646s1c1
Sequence:CCGGGCAAAGGATTACTTCTTCAAACTCGAGTTTGAAGAAGTAATCCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-487s1c1
Sequence:CCGGGCTGATTATTACAAAGGAGAACTCGAGTTCTCCTTTGTAATAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-712s1c1
Sequence:CCGGGCTCTTGAGAAATATGAGGAACTCGAGTTCCTCATATTTCTCAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022080.2-2152s21c1
Sequence:CCGGTCATGAACTTGATCCTATTAACTCGAGTTAATAGGATCAAGTTCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022080.1-1189s21c1
Sequence:CCGGAGAATCTCATCCCTCATATTTCTCGAGAAATATGAGGGATGAGATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-578s21c1
Sequence:GTACCGGAGAAAGCCATTGAGATCTATGCTCGAGCATAGATCTCAATGGCTTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-338s21c1
Sequence:CCGGAGGCTATCAACTGCTTAAATGCTCGAGCATTTAAGCAGTTGATAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-403s21c1
Sequence:CCGGGCCAAGCACCACATTACTATTCTCGAGAATAGTAATGTGGTGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000229280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-476s21c1
Sequence:CCGGATGAACAATCTGCTGATTATTCTCGAGAATAATCAGCAGATTGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022080
NAPB MISSION shRNA Lentiviral Transduction Particles
N-ethylmaleimide-sensitive factor attachment protein, beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-829s1c1
Sequence:CCGGGTGAAGGAATTTGACTCAATACTCGAGTATTGAGTCAAATTCCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-411s1c1
Sequence:CCGGCCACATTACTATTGCAGAGATCTCGAGATCTCTGCAATAGTAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-646s1c1
Sequence:CCGGGCAAAGGATTACTTCTTCAAACTCGAGTTTGAAGAAGTAATCCTTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-487s1c1
Sequence:CCGGGCTGATTATTACAAAGGAGAACTCGAGTTCTCCTTTGTAATAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022080.1-712s1c1
Sequence:CCGGGCTCTTGAGAAATATGAGGAACTCGAGTTCCTCATATTTCTCAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022080.2-2152s21c1
Sequence:CCGGTCATGAACTTGATCCTATTAACTCGAGTTAATAGGATCAAGTTCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022080.1-1189s21c1
Sequence:CCGGAGAATCTCATCCCTCATATTTCTCGAGAAATATGAGGGATGAGATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-578s21c1
Sequence:GTACCGGAGAAAGCCATTGAGATCTATGCTCGAGCATAGATCTCAATGGCTTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-338s21c1
Sequence:CCGGAGGCTATCAACTGCTTAAATGCTCGAGCATTTAAGCAGTTGATAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-403s21c1
Sequence:CCGGGCCAAGCACCACATTACTATTCTCGAGAATAGTAATGTGGTGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000229280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022080.1-476s21c1
Sequence:CCGGATGAACAATCTGCTGATTATTCTCGAGAATAATCAGCAGATTGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)