EMAIL THIS PAGE TO A FRIEND

NAPEPLD

N-acyl phosphatidylethanolamine phospholipase D

129 Gene Product Result for
Synonyms: FMP30 NAPE-PLD
UniProtKB ID: Q6IQ20, Q5CZ87, Q769K1
Gene ID:
Human(222236) Summary: NAPEPLD is a phospholipase D type enzyme that catalyzes the release of N-acylethanolamine (NAE) from N-acyl-phosphatidylethanolamine (NAPE) in the second step of the biosynthesis of N-acylethanolamine (Okamoto et al., 2004 [PubMed 14634025]
Mouse(242864) N-acyl phosphatidylethanolamine phospholipase D
Rat(296757) N-acyl phosphatidylethanolamine phospholipase D
Zebrafish(568061) N-acyl phosphatidylethanolamine phospholipase D
chicken(417719) N-acyl phosphatidylethanolamine phospholipase D
dog(475898) N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase D-like
domestic cat(101090597) N-acyl phosphatidylethanolamine phospholipase D
Horse(100050247) N-acyl phosphatidylethanolamine phospholipase D
cow(541291) N-acyl phosphatidylethanolamine phospholipase D
dog(100685330) N-acyl phosphatidylethanolamine phospholipase D
domestic guinea pig(100724473) N-acyl phosphatidylethanolamine phospholipase D
naked mole-rat(101722949) N-acyl phosphatidylethanolamine phospholipase D
sheep(101119039) N-acyl phosphatidylethanolamine phospholipase D
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198990 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122838 Rosetta Predictions human pricing
NM_198990 Rosetta Predictions human pricing
NM_199381 Rosetta Predictions rat pricing
NM_178728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327457 predicted 688
2 SASI_Hs02_00327458 predicted 884
3 SASI_Hs02_00327459 predicted 720
4 SASI_Hs02_00327460 predicted 856
5 SASI_Hs02_00327461 predicted 851
6 SASI_Hs02_00327462 predicted 591
7 SASI_Hs02_00327463 predicted 592
8 SASI_Hs02_00327464 predicted 794
9 SASI_Hs02_00327465 predicted 579
10 SASI_Hs02_00327466 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132154 predicted 683
2 SASI_Hs01_00132156 predicted 891
3 SASI_Hs02_00372502 predicted 721
4 SASI_Hs01_00132158 predicted 847
5 SASI_Hs01_00132159 predicted 852
6 SASI_Hs01_00132160 predicted 594
7 SASI_Hs01_00132161 predicted 595
8 SASI_Hs01_00132162 predicted 792
9 SASI_Hs01_00132163 predicted 585
10 SASI_Hs02_00372503 predicted 894
11 SASI_Hs01_00132155 predicted 648
12 SASI_Hs01_00132157 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099663 predicted 913
2 SASI_Rn02_00270191 predicted 265
3 SASI_Rn02_00270192 predicted 679
4 SASI_Rn01_00099665 predicted 749
5 SASI_Rn01_00099666 predicted 600
6 SASI_Rn01_00099667 predicted 278
7 SASI_Rn02_00270193 predicted 932
8 SASI_Rn01_00099669 predicted 235
9 SASI_Rn01_00099670 predicted 296
10 SASI_Rn01_00099671 predicted 527
11 SASI_Rn01_00099664 predicted 942
12 SASI_Rn01_00099668 predicted 301
13 SASI_Rn01_00099672 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136442 predicted 1186
2 SASI_Mm01_00136443 predicted 1254
3 SASI_Mm01_00136445 predicted 1229
4 SASI_Mm01_00136446 predicted 211
5 SASI_Mm01_00136447 predicted 304
6 SASI_Mm02_00349257 predicted 229
7 SASI_Mm01_00136449 predicted 1235
8 SASI_Mm01_00136450 predicted 436
9 SASI_Mm01_00136451 predicted 686
10 SASI_Mm02_00349258 predicted 1134
11 SASI_Mm01_00136444 predicted 1251
12 SASI_Mm01_00136448 predicted 1303
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198990
VALIDATED
NAPEPLD MISSION shRNA Bacterial Glycerol Stock
N-acyl phosphatidylethanolamine phospholipase D
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-472s21c1
Sequence:CCGGTAGACTAGAAGAAGATGTAACCTCGAGGTTACATCTTCTTCTAGTCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-740s21c1
Sequence:CCGGGAAATGGATGAGCTCATATTTCTCGAGAAATATGAGCTCATCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-1264s21c1
Sequence:CCGGACCGAGGTGGTTTATGAAATACTCGAGTATTTCATAAACCACCTCGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-362s21c1
Sequence:CCGGACAAGCAGCCAATATCCTAAACTCGAGTTTAGGATATTGGCTGCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-891s21c1
Sequence:CCGGATGACCATCTGGACTACAATTCTCGAGAATTGTAGTCCAGATGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-564s21c1
Sequence:CCGGATGTTCTCAGATGGCTGATAACTCGAGTTATCAGCCATCTGAGAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_198990.2-191s1c1
Sequence:CCGGGCAAGTGATTCTTCTAGGTTTCTCGAGAAACCTAGAAGAATCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198990.2-406s1c1
Sequence:CCGGCCCAGTGCTTAAGCCATATTTCTCGAGAAATATGGCTTAAGCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_198990.2-1007s1c1
Sequence:CCGGGCTATTCCCATCGGAGCTTATCTCGAGATAAGCTCCGATGGGAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198990.2-682s1c1
Sequence:CCGGCATTGCTTTGAATGAGCGATTCTCGAGAATCGCTCATTCAAAGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_198990.2-1198s1c1
Sequence:CCGGCGGACTTAACGCTGAAGATTTCTCGAGAAATCTTCAGCGTTAAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198990.4-1709s21c1
Sequence:CCGGGCAATTCTTGCTCTATCAAATCTCGAGATTTGATAGAGCAAGAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198990
VALIDATED
NAPEPLD MISSION shRNA shRNA Plasmid DNA
N-acyl phosphatidylethanolamine phospholipase D
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-472s21c1
Sequence:CCGGTAGACTAGAAGAAGATGTAACCTCGAGGTTACATCTTCTTCTAGTCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-740s21c1
Sequence:CCGGGAAATGGATGAGCTCATATTTCTCGAGAAATATGAGCTCATCCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-1264s21c1
Sequence:CCGGACCGAGGTGGTTTATGAAATACTCGAGTATTTCATAAACCACCTCGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-362s21c1
Sequence:CCGGACAAGCAGCCAATATCCTAAACTCGAGTTTAGGATATTGGCTGCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-891s21c1
Sequence:CCGGATGACCATCTGGACTACAATTCTCGAGAATTGTAGTCCAGATGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-564s21c1
Sequence:CCGGATGTTCTCAGATGGCTGATAACTCGAGTTATCAGCCATCTGAGAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_198990.2-191s1c1
Sequence:CCGGGCAAGTGATTCTTCTAGGTTTCTCGAGAAACCTAGAAGAATCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198990.2-406s1c1
Sequence:CCGGCCCAGTGCTTAAGCCATATTTCTCGAGAAATATGGCTTAAGCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_198990.2-1007s1c1
Sequence:CCGGGCTATTCCCATCGGAGCTTATCTCGAGATAAGCTCCGATGGGAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198990.2-682s1c1
Sequence:CCGGCATTGCTTTGAATGAGCGATTCTCGAGAATCGCTCATTCAAAGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_198990.2-1198s1c1
Sequence:CCGGCGGACTTAACGCTGAAGATTTCTCGAGAAATCTTCAGCGTTAAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198990.4-1709s21c1
Sequence:CCGGGCAATTCTTGCTCTATCAAATCTCGAGATTTGATAGAGCAAGAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198990
VALIDATED
NAPEPLD MISSION shRNA Lentiviral Transduction Particles
N-acyl phosphatidylethanolamine phospholipase D
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-472s21c1
Sequence:CCGGTAGACTAGAAGAAGATGTAACCTCGAGGTTACATCTTCTTCTAGTCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-740s21c1
Sequence:CCGGGAAATGGATGAGCTCATATTTCTCGAGAAATATGAGCTCATCCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-1264s21c1
Sequence:CCGGACCGAGGTGGTTTATGAAATACTCGAGTATTTCATAAACCACCTCGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-362s21c1
Sequence:CCGGACAAGCAGCCAATATCCTAAACTCGAGTTTAGGATATTGGCTGCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-891s21c1
Sequence:CCGGATGACCATCTGGACTACAATTCTCGAGAATTGTAGTCCAGATGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198990.4-564s21c1
Sequence:CCGGATGTTCTCAGATGGCTGATAACTCGAGTTATCAGCCATCTGAGAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_198990.2-191s1c1
Sequence:CCGGGCAAGTGATTCTTCTAGGTTTCTCGAGAAACCTAGAAGAATCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198990.2-406s1c1
Sequence:CCGGCCCAGTGCTTAAGCCATATTTCTCGAGAAATATGGCTTAAGCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_198990.2-1007s1c1
Sequence:CCGGGCTATTCCCATCGGAGCTTATCTCGAGATAAGCTCCGATGGGAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198990.2-682s1c1
Sequence:CCGGCATTGCTTTGAATGAGCGATTCTCGAGAATCGCTCATTCAAAGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_198990.2-1198s1c1
Sequence:CCGGCGGACTTAACGCTGAAGATTTCTCGAGAAATCTTCAGCGTTAAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436621    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198990.4-1709s21c1
Sequence:CCGGGCAATTCTTGCTCTATCAAATCTCGAGATTTGATAGAGCAAGAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178728
NAPEPLD MISSION shRNA Bacterial Glycerol Stock
N-acyl phosphatidylethanolamine phospholipase D
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-1191s21c1
Sequence:CCGGGGACGTTTGCCTTAGCTAATGCTCGAGCATTAGCTAAGGCAAACGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-1309s21c1
Sequence:CCGGATACTTGAATACCGATGATAGCTCGAGCTATCATCGGTATTCAAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-1249s21c1
Sequence:CCGGTCTAGAGAGATACGGACTTTCCTCGAGGAAAGTCCGTATCTCTCTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-186s21c1
Sequence:CCGGCAGCGCCAAGCTATCAGTATCCTCGAGGATACTGATAGCTTGGCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178728.5-1494s21c1
Sequence:CCGGAGTCTAGGGATGGGTTATTTACTCGAGTAAATAACCCATCCCTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178728
NAPEPLD MISSION shRNA shRNA Plasmid DNA
N-acyl phosphatidylethanolamine phospholipase D
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-1191s21c1
Sequence:CCGGGGACGTTTGCCTTAGCTAATGCTCGAGCATTAGCTAAGGCAAACGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-1309s21c1
Sequence:CCGGATACTTGAATACCGATGATAGCTCGAGCTATCATCGGTATTCAAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-1249s21c1
Sequence:CCGGTCTAGAGAGATACGGACTTTCCTCGAGGAAAGTCCGTATCTCTCTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-186s21c1
Sequence:CCGGCAGCGCCAAGCTATCAGTATCCTCGAGGATACTGATAGCTTGGCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178728.5-1494s21c1
Sequence:CCGGAGTCTAGGGATGGGTTATTTACTCGAGTAAATAACCCATCCCTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178728
NAPEPLD MISSION shRNA Lentiviral Transduction Particles
N-acyl phosphatidylethanolamine phospholipase D
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-1191s21c1
Sequence:CCGGGGACGTTTGCCTTAGCTAATGCTCGAGCATTAGCTAAGGCAAACGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-1309s21c1
Sequence:CCGGATACTTGAATACCGATGATAGCTCGAGCTATCATCGGTATTCAAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-1249s21c1
Sequence:CCGGTCTAGAGAGATACGGACTTTCCTCGAGGAAAGTCCGTATCTCTCTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178728.5-186s21c1
Sequence:CCGGCAGCGCCAAGCTATCAGTATCCTCGAGGATACTGATAGCTTGGCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178728.5-1494s21c1
Sequence:CCGGAGTCTAGGGATGGGTTATTTACTCGAGTAAATAACCCATCCCTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)