EMAIL THIS PAGE TO A FRIEND

NAPG

N-ethylmaleimide-sensitive factor attachment protein, gamma

88 Gene Product Result for
Synonyms: GAMMASNAP
UniProtKB ID: Q99747, Q9BUV1
Gene ID:
Human(8774) Summary: This gene encodes soluble NSF attachment protein gamma. The soluble NSF attachment proteins (SNAPs) enable N-ethyl-maleimide-sensitive fusion protein (NSF) to bind to target membranes. NSF and SNAPs appear to be general components of the intracellular membrane fusion apparatus, and their action at specific sites of fusion must be controlled by SNAP receptors particular to the membranes being fused. The product of this gene mediates platelet exocytosis and controls the membrane fusion events of this process.[provided by RefSeq, Dec 2008]
Mouse(108123) N-ethylmaleimide sensitive fusion protein attachment protein gamma
Rat(307382) N-ethylmaleimide-sensitive factor attachment protein, gamma
sheep(101108096) N-ethylmaleimide-sensitive factor attachment protein, gamma
naked mole-rat(101714883) N-ethylmaleimide-sensitive factor attachment protein, gamma
domestic guinea pig(100718181) N-ethylmaleimide-sensitive factor attachment protein, gamma
Zebrafish(436742) N-ethylmaleimide-sensitive factor attachment protein, gamma
cow(509041) N-ethylmaleimide-sensitive factor attachment protein, gamma
domestic cat(101099595) N-ethylmaleimide-sensitive factor attachment protein, gamma
dog(608647) N-ethylmaleimide-sensitive factor attachment protein, gamma
chicken(421051) N-ethylmaleimide-sensitive factor attachment protein, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003826 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028017 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028017 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028017 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003826 Rosetta Predictions human pricing
NM_001107384 Rosetta Predictions rat pricing
NM_028017 Rosetta Predictions mouse pricing
XM_001002429 Rosetta Predictions mouse pricing
XM_001002439 Rosetta Predictions mouse pricing
XM_001002452 Rosetta Predictions mouse pricing
XM_901886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116765 predicted 628
2 SASI_Hs01_00116766 predicted 711
3 SASI_Hs01_00116768 predicted 915
4 SASI_Hs01_00116769 predicted 724
5 SASI_Hs01_00116770 predicted 453
6 SASI_Hs01_00116772 predicted 515
7 SASI_Hs01_00116773 predicted 573
8 SASI_Hs01_00116774 predicted 620
9 SASI_Hs02_00336377 predicted 470
10 SASI_Hs02_00336378 predicted 659
11 SASI_Hs01_00116767 predicted 678
12 SASI_Hs01_00116771 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107384 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228285 predicted 1226
2 SASI_Rn02_00228286 predicted 611
3 SASI_Rn02_00228287 predicted 510
4 SASI_Rn02_00228288 predicted 1317
5 SASI_Rn02_00228289 predicted 1328
6 SASI_Rn02_00228290 predicted 615
7 SASI_Rn02_00228291 predicted 830
8 SASI_Rn02_00228292 predicted 671
9 SASI_Rn02_00228293 predicted 829
10 SASI_Rn02_00228294 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333143 predicted 717
2 SASI_Mm02_00333144 predicted 608
3 SASI_Mm02_00333145 predicted 1007
4 SASI_Mm02_00333146 predicted 1232
5 SASI_Mm02_00333147 predicted 1230
6 SASI_Mm02_00333148 predicted 504
7 SASI_Mm02_00333149 predicted 641
8 SASI_Mm02_00333150 predicted 1082
9 SASI_Mm02_00333151 predicted 980
10 SASI_Mm02_00333152 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00269923 predicted 1113
2 SASI_Mm01_00269924 predicted 428
3 SASI_Mm01_00269925 predicted 821
4 SASI_Mm01_00269926 predicted 1045
5 SASI_Mm01_00269927 predicted 1080
6 SASI_Mm01_00269928 predicted 455
7 SASI_Mm01_00269929 predicted 899
8 SASI_Mm01_00269930 predicted 793
9 SASI_Mm01_00269931 predicted 420
10 SASI_Mm01_00269932 predicted 488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209756 predicted 1232
2 SASI_Mm01_00209757 predicted 541
3 SASI_Mm01_00209758 predicted 947
4 SASI_Mm01_00209759 predicted 1170
5 SASI_Mm01_00209760 predicted 442
6 SASI_Mm01_00209761 predicted 568
7 SASI_Mm01_00209762 predicted 1018
8 SASI_Mm01_00209763 predicted 914
9 SASI_Mm01_00209764 predicted 540
10 SASI_Mm01_00209765 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001002452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243807 predicted 698
2 SASI_Mm01_00243808 predicted 1099
3 SASI_Mm01_00243809 predicted 1317
4 SASI_Mm01_00243810 predicted 594
5 SASI_Mm01_00243811 predicted 1352
6 SASI_Mm01_00243812 predicted 720
7 SASI_Mm01_00243813 predicted 1170
8 SASI_Mm01_00243814 predicted 1072
9 SASI_Mm01_00243815 predicted 687
10 SASI_Mm01_00243816 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271788 predicted 314
2 SASI_Mm01_00271789 predicted 230
3 SASI_Mm01_00271790 predicted 315
4 SASI_Mm01_00271791 predicted 308
5 SASI_Mm01_00271792 predicted 378
6 SASI_Mm01_00271793 predicted 222
7 SASI_Mm01_00271794 predicted 250
8 SASI_Mm01_00271795 predicted 231
9 SASI_Mm01_00271796 predicted 374
10 SASI_Mm01_00271797 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003826
VALIDATED
NAPG MISSION shRNA Bacterial Glycerol Stock
N-ethylmaleimide-sensitive factor attachment protein, gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-593s1c1
Sequence:CCGGGCACTCTCTATTCAGAAAGAACTCGAGTTCTTTCTGAATAGAGAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003826.2-1570s21c1
Sequence:GTACCGGAGGTGATGTTTACTGATAAATCTCGAGATTTATCAGTAAACATCACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-668s1c1
Sequence:CCGGGCTCAAGTCTTAGTTCATCTACTCGAGTAGATGAACTAAGACTTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_003826.1-374s1c1
Sequence:CCGGGCCAGCATGATGTATCTAGAACTCGAGTTCTAGATACATCATGCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-524s1c1
Sequence:CCGGCGACAGGCAGTTGAATTACTACTCGAGTAGTAATTCAACTGCCTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-310s1c1
Sequence:CCGGGCAAGCTGGAATGATGTTGAACTCGAGTTCAACATCATTCCAGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003826.2-789s21c1
Sequence:GTACCGGGAGAATTATCCAACTTGTTATCTCGAGATAACAAGTTGGATAATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003826.2-1243s21c1
Sequence:GTACCGGAGGGATATCCGTACTTCATTACTCGAGTAATGAAGTACGGATATCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003826.2-582s21c1
Sequence:GTACCGGGAGCGAGCTGGAAAGCTTATACTCGAGTATAAGCTTTCCAGCTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003826.2-1481s21c1
Sequence:GTACCGGGGGTAATAAGCATAGGTATTCCTCGAGGAATACCTATGCTTATTACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003826
VALIDATED
NAPG MISSION shRNA shRNA Plasmid DNA
N-ethylmaleimide-sensitive factor attachment protein, gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-593s1c1
Sequence:CCGGGCACTCTCTATTCAGAAAGAACTCGAGTTCTTTCTGAATAGAGAGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003826.2-1570s21c1
Sequence:GTACCGGAGGTGATGTTTACTGATAAATCTCGAGATTTATCAGTAAACATCACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-668s1c1
Sequence:CCGGGCTCAAGTCTTAGTTCATCTACTCGAGTAGATGAACTAAGACTTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_003826.1-374s1c1
Sequence:CCGGGCCAGCATGATGTATCTAGAACTCGAGTTCTAGATACATCATGCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-524s1c1
Sequence:CCGGCGACAGGCAGTTGAATTACTACTCGAGTAGTAATTCAACTGCCTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-310s1c1
Sequence:CCGGGCAAGCTGGAATGATGTTGAACTCGAGTTCAACATCATTCCAGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003826.2-789s21c1
Sequence:GTACCGGGAGAATTATCCAACTTGTTATCTCGAGATAACAAGTTGGATAATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003826.2-1243s21c1
Sequence:GTACCGGAGGGATATCCGTACTTCATTACTCGAGTAATGAAGTACGGATATCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003826.2-582s21c1
Sequence:GTACCGGGAGCGAGCTGGAAAGCTTATACTCGAGTATAAGCTTTCCAGCTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003826.2-1481s21c1
Sequence:GTACCGGGGGTAATAAGCATAGGTATTCCTCGAGGAATACCTATGCTTATTACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003826
VALIDATED
NAPG MISSION shRNA Lentiviral Transduction Particles
N-ethylmaleimide-sensitive factor attachment protein, gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-593s1c1
Sequence:CCGGGCACTCTCTATTCAGAAAGAACTCGAGTTCTTTCTGAATAGAGAGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003826.2-1570s21c1
Sequence:GTACCGGAGGTGATGTTTACTGATAAATCTCGAGATTTATCAGTAAACATCACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-668s1c1
Sequence:CCGGGCTCAAGTCTTAGTTCATCTACTCGAGTAGATGAACTAAGACTTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_003826.1-374s1c1
Sequence:CCGGGCCAGCATGATGTATCTAGAACTCGAGTTCTAGATACATCATGCTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-524s1c1
Sequence:CCGGCGACAGGCAGTTGAATTACTACTCGAGTAGTAATTCAACTGCCTGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003826.1-310s1c1
Sequence:CCGGGCAAGCTGGAATGATGTTGAACTCGAGTTCAACATCATTCCAGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003826.2-789s21c1
Sequence:GTACCGGGAGAATTATCCAACTTGTTATCTCGAGATAACAAGTTGGATAATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003826.2-1243s21c1
Sequence:GTACCGGAGGGATATCCGTACTTCATTACTCGAGTAATGAAGTACGGATATCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003826.2-582s21c1
Sequence:GTACCGGGAGCGAGCTGGAAAGCTTATACTCGAGTATAAGCTTTCCAGCTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003826.2-1481s21c1
Sequence:GTACCGGGGGTAATAAGCATAGGTATTCCTCGAGGAATACCTATGCTTATTACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028017
VALIDATED
NAPG MISSION shRNA Bacterial Glycerol Stock
N-ethylmaleimide-sensitive factor attachment protein, gamma
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028017.1-837s21c1
Sequence:CCGGATGGACAATGATTACGCTAAGCTCGAGCTTAGCGTAATCATTGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028017.1-268s21c1
Sequence:CCGGTTCATGCTGCCAAAGCTTATGCTCGAGCATAAGCTTTGGCAGCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028017.1-1950s21c1
Sequence:CCGGGCCCTTGTGTGTGACTATAAACTCGAGTTTATAGTCACACACAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-617s21c1
Sequence:GTACCGGGAACTACCCAACTTGTTATAACTCGAGTTATAACAAGTTGGGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-334s21c1
Sequence:CCGGCAGTGCAGCTGATCGAGAAAGCTCGAGCTTTCTCGATCAGCTGCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-714s21c1
Sequence:CCGGTACAGCATACCAGGCTTTAACCTCGAGGTTAAAGCCTGGTATGCTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-415s21c1
Sequence:CCGGCCGGAAAGCTCATAGAGAATGCTCGAGCATTCTCTATGAGCTTTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-564s21c1
Sequence:CCGGGATGAAGCTGCACTGTCTATTCTCGAGAATAGACAGTGCAGCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-664s21c1
Sequence:CCGGATCTACACAGAAATGACTATGCTCGAGCATAGTCATTTCTGTGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028017
VALIDATED
NAPG MISSION shRNA shRNA Plasmid DNA
N-ethylmaleimide-sensitive factor attachment protein, gamma
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028017.1-837s21c1
Sequence:CCGGATGGACAATGATTACGCTAAGCTCGAGCTTAGCGTAATCATTGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028017.1-268s21c1
Sequence:CCGGTTCATGCTGCCAAAGCTTATGCTCGAGCATAAGCTTTGGCAGCATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028017.1-1950s21c1
Sequence:CCGGGCCCTTGTGTGTGACTATAAACTCGAGTTTATAGTCACACACAAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-617s21c1
Sequence:GTACCGGGAACTACCCAACTTGTTATAACTCGAGTTATAACAAGTTGGGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-334s21c1
Sequence:CCGGCAGTGCAGCTGATCGAGAAAGCTCGAGCTTTCTCGATCAGCTGCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-714s21c1
Sequence:CCGGTACAGCATACCAGGCTTTAACCTCGAGGTTAAAGCCTGGTATGCTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000225761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-415s21c1
Sequence:CCGGCCGGAAAGCTCATAGAGAATGCTCGAGCATTCTCTATGAGCTTTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-564s21c1
Sequence:CCGGGATGAAGCTGCACTGTCTATTCTCGAGAATAGACAGTGCAGCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-664s21c1
Sequence:CCGGATCTACACAGAAATGACTATGCTCGAGCATAGTCATTTCTGTGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028017
VALIDATED
NAPG MISSION shRNA Lentiviral Transduction Particles
N-ethylmaleimide-sensitive factor attachment protein, gamma
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028017.1-837s21c1
Sequence:CCGGATGGACAATGATTACGCTAAGCTCGAGCTTAGCGTAATCATTGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028017.1-268s21c1
Sequence:CCGGTTCATGCTGCCAAAGCTTATGCTCGAGCATAAGCTTTGGCAGCATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028017.1-1950s21c1
Sequence:CCGGGCCCTTGTGTGTGACTATAAACTCGAGTTTATAGTCACACACAAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-617s21c1
Sequence:GTACCGGGAACTACCCAACTTGTTATAACTCGAGTTATAACAAGTTGGGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-334s21c1
Sequence:CCGGCAGTGCAGCTGATCGAGAAAGCTCGAGCTTTCTCGATCAGCTGCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-714s21c1
Sequence:CCGGTACAGCATACCAGGCTTTAACCTCGAGGTTAAAGCCTGGTATGCTGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000225761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-415s21c1
Sequence:CCGGCCGGAAAGCTCATAGAGAATGCTCGAGCATTCTCTATGAGCTTTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-564s21c1
Sequence:CCGGGATGAAGCTGCACTGTCTATTCTCGAGAATAGACAGTGCAGCTTCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028017.1-664s21c1
Sequence:CCGGATCTACACAGAAATGACTATGCTCGAGCATAGTCATTTCTGTGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)