EMAIL THIS PAGE TO A FRIEND

NAPRT1

nicotinate phosphoribosyltransferase domain containing 1

71 Gene Product Result for
Synonyms: PP3856
Gene ID:
Human(93100) Summary: Nicotinic acid (NA; niacin) is converted by nicotinic acid phosphoribosyltransferase (NAPRT; EC 2.4.2.11) to NA mononucleotide (NaMN), which is then converted to NA adenine dinucleotide (NaAD), and finally to nicotinamide adenine dinucleotide (NAD), which serves as a coenzyme in cellular redox reactions and is an essential component of a variety of processes in cellular metabolism including response to stress (Hara et al., 2007).[supplied by OMIM, Mar 2008]
Mouse(223646) nicotinate phosphoribosyltransferase domain containing 1
Rat(315085) nicotinate phosphoribosyltransferase domain containing 1
Thale Cress(829848) nicotinate phosphoribosyltransferase 1
chicken(404301) nicotinate phosphoribosyltransferase domain containing 1
dog(609412) nicotinate phosphoribosyltransferase domain containing 1
domestic cat(101089984) nicotinate phosphoribosyltransferase domain containing 1
cow(399559) nicotinate phosphoribosyltransferase domain containing 1
Zebrafish(393864) nicotinate phosphoribosyltransferase domain containing 1
domestic guinea pig(100730251) nicotinate phosphoribosyltransferase domain containing 1
naked mole-rat(101721764) nicotinate phosphoribosyltransferase domain containing 1
sheep(101113505) nicotinate phosphoribosyltransferase domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023739 Anti-NAPRT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunofluorescence, immunohistochemistry, western blot pricing
HPA024017 Anti-NAPRT antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB1400768 Anti-NAPRT1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2107737 Anti-NAPRT1 antibody produced in rabbit affinity isolated antibody guinea pig, horse, mouse, human
ELISA, western blot pricing
SAB1411642 Anti-NAPRT1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
AMAB90823 Monoclonal Anti-NAPRT antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0665, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AMAB90725 Monoclonal Anti-NAPRT antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL0366, purified immunoglobulin, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1403426 Monoclonal Anti-NAPRT1, (N-terminal) antibody produced in mouse clone 4A9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172607 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172607 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172607 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145201 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145201 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145201 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145201 Rosetta Predictions human pricing
NM_207609 Rosetta Predictions rat pricing
NM_172607 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206354 predicted 1109
2 SASI_Hs01_00206356 predicted 1312
3 SASI_Hs02_00365045 predicted 965
4 SASI_Hs01_00206358 predicted 1043
5 SASI_Hs02_00365046 predicted 1118
6 SASI_Hs01_00206359 predicted 1163
7 SASI_Hs01_00206360 predicted 1282
8 SASI_Hs01_00206361 predicted 557
9 SASI_Hs01_00206362 predicted 1124
10 SASI_Hs01_00206363 predicted 1210
11 SASI_Hs01_00206355 predicted 811
12 SASI_Hs01_00206357 predicted 645
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108256 predicted 1182
2 SASI_Rn01_00108257 predicted 1241
3 SASI_Rn01_00108258 predicted 1108
4 SASI_Rn02_00270437 predicted 659
5 SASI_Rn01_00108259 predicted 329
6 SASI_Rn01_00108260 predicted 919
7 SASI_Rn01_00108261 predicted 554
8 SASI_Rn01_00108262 predicted 1125
9 SASI_Rn01_00108263 predicted 1522
10 SASI_Rn01_00108264 predicted 1421
11 SASI_Rn01_00108265 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172607 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068575 predicted 1397
2 SASI_Mm01_00068576 predicted 818
3 SASI_Mm01_00068577 predicted 306
4 SASI_Mm01_00068578 predicted 1216
5 SASI_Mm01_00068579 predicted 463
6 SASI_Mm01_00068580 predicted 1283
7 SASI_Mm01_00068581 predicted 715
8 SASI_Mm01_00068582 predicted 1259
9 SASI_Mm01_00068583 predicted 518
10 SASI_Mm02_00344306 predicted 791
11 SASI_Mm01_00068574 predicted 1353
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172607
NAPRT1 MISSION shRNA Bacterial Glycerol Stock
nicotinate phosphoribosyltransferase domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172607.3-773s21c1
Sequence:CCGGGGGTTTCACGGCCTCAATTTACTCGAGTAAATTGAGGCCGTGAAACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172607.3-471s21c1
Sequence:CCGGCAGTTCCTGGCTTCGGTACTACTCGAGTAGTACCGAAGCCAGGAACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172607.3-961s21c1
Sequence:CCGGACCTGCCTGCCAGGGTAAATTCTCGAGAATTTACCCTGGCAGGCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-423s1c1
Sequence:CCGGCAGGACTGTATGCGCTTTCTTCTCGAGAAGAAAGCGCATACAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-1047s1c1
Sequence:CCGGCGCGCAGCATTTGTGGCCTATCTCGAGATAGGCCACAAATGCTGCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-510s1c1
Sequence:CCGGCCTGCGTTCTTCGAGCACCTTCTCGAGAAGGTGCTCGAAGAACGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-878s1c1
Sequence:CCGGCCACTCCTTTGTCACTTCATTCTCGAGAATGAAGTGACAAAGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-1131s1c1
Sequence:CCGGCTTCCTAACTTCCTGGCAGTACTCGAGTACTGCCAGGAAGTTAGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172607
NAPRT1 MISSION shRNA shRNA Plasmid DNA
nicotinate phosphoribosyltransferase domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172607.3-773s21c1
Sequence:CCGGGGGTTTCACGGCCTCAATTTACTCGAGTAAATTGAGGCCGTGAAACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172607.3-471s21c1
Sequence:CCGGCAGTTCCTGGCTTCGGTACTACTCGAGTAGTACCGAAGCCAGGAACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172607.3-961s21c1
Sequence:CCGGACCTGCCTGCCAGGGTAAATTCTCGAGAATTTACCCTGGCAGGCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-423s1c1
Sequence:CCGGCAGGACTGTATGCGCTTTCTTCTCGAGAAGAAAGCGCATACAGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-1047s1c1
Sequence:CCGGCGCGCAGCATTTGTGGCCTATCTCGAGATAGGCCACAAATGCTGCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-510s1c1
Sequence:CCGGCCTGCGTTCTTCGAGCACCTTCTCGAGAAGGTGCTCGAAGAACGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-878s1c1
Sequence:CCGGCCACTCCTTTGTCACTTCATTCTCGAGAATGAAGTGACAAAGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-1131s1c1
Sequence:CCGGCTTCCTAACTTCCTGGCAGTACTCGAGTACTGCCAGGAAGTTAGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172607
NAPRT1 MISSION shRNA Lentiviral Transduction Particles
nicotinate phosphoribosyltransferase domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172607.3-773s21c1
Sequence:CCGGGGGTTTCACGGCCTCAATTTACTCGAGTAAATTGAGGCCGTGAAACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172607.3-471s21c1
Sequence:CCGGCAGTTCCTGGCTTCGGTACTACTCGAGTAGTACCGAAGCCAGGAACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172607.3-961s21c1
Sequence:CCGGACCTGCCTGCCAGGGTAAATTCTCGAGAATTTACCCTGGCAGGCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-423s1c1
Sequence:CCGGCAGGACTGTATGCGCTTTCTTCTCGAGAAGAAAGCGCATACAGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-1047s1c1
Sequence:CCGGCGCGCAGCATTTGTGGCCTATCTCGAGATAGGCCACAAATGCTGCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-510s1c1
Sequence:CCGGCCTGCGTTCTTCGAGCACCTTCTCGAGAAGGTGCTCGAAGAACGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-878s1c1
Sequence:CCGGCCACTCCTTTGTCACTTCATTCTCGAGAATGAAGTGACAAAGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172607.2-1131s1c1
Sequence:CCGGCTTCCTAACTTCCTGGCAGTACTCGAGTACTGCCAGGAAGTTAGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145201
NAPRT1 MISSION shRNA Bacterial Glycerol Stock
nicotinate phosphoribosyltransferase domain containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-94s21c1
Sequence:CCGGCACCATGGCGTTGGGCTATTGCTCGAGCAATAGCCCAACGCCATGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1192s21c1
Sequence:CCGGTTCCCTGGGTGGCGTCTATAACTCGAGTTATAGACGCCACCCAGGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1069s21c1
Sequence:CCGGGTCAGTCCTCATCGTAGTCAGCTCGAGCTGACTACGATGAGGACTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1134s21c1
Sequence:CCGGGCAGTGAGGTGAATGTCATTGCTCGAGCAATGACATTCACCTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1325s21c1
Sequence:CCGGCTCATGGACATGCTGCAGTTACTCGAGTAACTGCAGCATGTCCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145201.3-1520s1c1
Sequence:CCGGGCTTCTCTTTCCTTACCTCCTCTCGAGAGGAGGTAAGGAAAGAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145201.3-1055s1c1
Sequence:CCGGCCTCATCGTAGTCAGCAACAACTCGAGTTGTTGCTGACTACGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145201
NAPRT1 MISSION shRNA shRNA Plasmid DNA
nicotinate phosphoribosyltransferase domain containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-94s21c1
Sequence:CCGGCACCATGGCGTTGGGCTATTGCTCGAGCAATAGCCCAACGCCATGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1192s21c1
Sequence:CCGGTTCCCTGGGTGGCGTCTATAACTCGAGTTATAGACGCCACCCAGGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1069s21c1
Sequence:CCGGGTCAGTCCTCATCGTAGTCAGCTCGAGCTGACTACGATGAGGACTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1134s21c1
Sequence:CCGGGCAGTGAGGTGAATGTCATTGCTCGAGCAATGACATTCACCTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1325s21c1
Sequence:CCGGCTCATGGACATGCTGCAGTTACTCGAGTAACTGCAGCATGTCCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145201.3-1520s1c1
Sequence:CCGGGCTTCTCTTTCCTTACCTCCTCTCGAGAGGAGGTAAGGAAAGAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145201.3-1055s1c1
Sequence:CCGGCCTCATCGTAGTCAGCAACAACTCGAGTTGTTGCTGACTACGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145201
NAPRT1 MISSION shRNA Lentiviral Transduction Particles
nicotinate phosphoribosyltransferase domain containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-94s21c1
Sequence:CCGGCACCATGGCGTTGGGCTATTGCTCGAGCAATAGCCCAACGCCATGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1192s21c1
Sequence:CCGGTTCCCTGGGTGGCGTCTATAACTCGAGTTATAGACGCCACCCAGGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1069s21c1
Sequence:CCGGGTCAGTCCTCATCGTAGTCAGCTCGAGCTGACTACGATGAGGACTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1134s21c1
Sequence:CCGGGCAGTGAGGTGAATGTCATTGCTCGAGCAATGACATTCACCTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145201.4-1325s21c1
Sequence:CCGGCTCATGGACATGCTGCAGTTACTCGAGTAACTGCAGCATGTCCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180525    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145201.3-1520s1c1
Sequence:CCGGGCTTCTCTTTCCTTACCTCCTCTCGAGAGGAGGTAAGGAAAGAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145201.3-1055s1c1
Sequence:CCGGCCTCATCGTAGTCAGCAACAACTCGAGTTGTTGCTGACTACGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)