EMAIL THIS PAGE TO A FRIEND

NAPSA

napsin A aspartic peptidase

69 Gene Product Result for
Synonyms: KAP Kdap NAP1 NAPA SNAPA
UniProtKB ID: O96009, Q8WWD9
Gene ID:
Human(9476) Summary: The activation peptides of aspartic proteinases plays role as inhibitors of the active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The pronapsin A gene is expressed predominantly in lung and kidney. Its translation product is predicted to be a fully functional, glycosylated aspartic proteinase precursor containing an RGD motif and an additional 18 residues at its C-terminus. [provided by RefSeq, Jul 2008]
Mouse(16541) napsin A aspartic peptidase
Rat(60575) napsin A aspartic peptidase
dog(476406) napsin A aspartic peptidase
cow(539259) napsin A aspartic peptidase
Horse(100057514) napsin A aspartic peptidase
domestic cat(101088129) napsin A aspartic peptidase
sheep(101116503) napsin A aspartic peptidase
naked mole-rat(101706612) napsin A aspartic peptidase
domestic guinea pig(100720123) napsin A aspartic peptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004851 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004851 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004851 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004851 Rosetta Predictions human pricing
NM_031670 Rosetta Predictions rat pricing
NM_008437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061511 predicted 724
2 SASI_Hs02_00338439 predicted 804
3 SASI_Hs01_00061514 predicted 399
4 SASI_Hs01_00061518 predicted 413
5 SASI_Hs02_00338440 predicted 1078
6 SASI_Hs02_00338441 predicted 1152
7 SASI_Hs02_00338442 predicted 1159
8 SASI_Hs02_00338443 predicted 428
9 SASI_Hs02_00338444 predicted 395
10 SASI_Hs01_00061512 predicted 445
11 SASI_Hs01_00061513 predicted 519
12 SASI_Hs01_00061515 predicted 813
13 SASI_Hs01_00061516 predicted 455
14 SASI_Hs01_00061517 predicted 611
15 SASI_Hs01_00061519 predicted 454
16 SASI_Hs01_00061520 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031670 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040377 predicted 687
2 SASI_Rn01_00040378 predicted 462
3 SASI_Rn01_00040379 predicted 1042
4 SASI_Rn02_00265012 predicted 342
5 SASI_Rn01_00040380 predicted 1023
6 SASI_Rn01_00040381 predicted 597
7 SASI_Rn01_00040382 predicted 905
8 SASI_Rn01_00040383 predicted 418
9 SASI_Rn02_00265013 predicted 548
10 SASI_Rn01_00040385 predicted 787
11 SASI_Rn01_00040376 predicted 882
12 SASI_Rn01_00040384 predicted 440
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098123 predicted 589
2 SASI_Mm01_00098124 predicted 1143
3 SASI_Mm02_00313911 predicted 420
4 SASI_Mm01_00098125 predicted 1217
5 SASI_Mm01_00098126 predicted 588
6 SASI_Mm01_00098127 predicted 1135
7 SASI_Mm01_00098128 predicted 556
8 SASI_Mm01_00098129 predicted 1133
9 SASI_Mm01_00098130 predicted 1027
10 SASI_Mm01_00098131 predicted 902
11 SASI_Mm01_00098132 predicted 1152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008437
NAPSA MISSION shRNA Bacterial Glycerol Stock
napsin A aspartic peptidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-1045s1c1
Sequence:CCGGCGGGCCTTGAATAAAGCCATTCTCGAGAATGGCTTTATTCAAGGCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-267s1c1
Sequence:CCGGCCTTGGACACAGAATCTTAAACTCGAGTTTAAGATTCTGTGTCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-415s1c1
Sequence:CCGGCCTCCTCAGAATTTCACCGTTCTCGAGAACGGTGAAATTCTGAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-503s1c1
Sequence:CCGGGCTGGTTTCACCATCGCTTTACTCGAGTAAAGCGATGGTGAAACCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-476s1c1
Sequence:CCGGCGAGATGTCATTTCTTCAGTTCTCGAGAACTGAAGAAATGACATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008437
NAPSA MISSION shRNA shRNA Plasmid DNA
napsin A aspartic peptidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-1045s1c1
Sequence:CCGGCGGGCCTTGAATAAAGCCATTCTCGAGAATGGCTTTATTCAAGGCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-267s1c1
Sequence:CCGGCCTTGGACACAGAATCTTAAACTCGAGTTTAAGATTCTGTGTCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-415s1c1
Sequence:CCGGCCTCCTCAGAATTTCACCGTTCTCGAGAACGGTGAAATTCTGAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-503s1c1
Sequence:CCGGGCTGGTTTCACCATCGCTTTACTCGAGTAAAGCGATGGTGAAACCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000030505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-476s1c1
Sequence:CCGGCGAGATGTCATTTCTTCAGTTCTCGAGAACTGAAGAAATGACATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008437
NAPSA MISSION shRNA Lentiviral Transduction Particles
napsin A aspartic peptidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-1045s1c1
Sequence:CCGGCGGGCCTTGAATAAAGCCATTCTCGAGAATGGCTTTATTCAAGGCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-267s1c1
Sequence:CCGGCCTTGGACACAGAATCTTAAACTCGAGTTTAAGATTCTGTGTCCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-415s1c1
Sequence:CCGGCCTCCTCAGAATTTCACCGTTCTCGAGAACGGTGAAATTCTGAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-503s1c1
Sequence:CCGGGCTGGTTTCACCATCGCTTTACTCGAGTAAAGCGATGGTGAAACCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000030505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008437.1-476s1c1
Sequence:CCGGCGAGATGTCATTTCTTCAGTTCTCGAGAACTGAAGAAATGACATCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004851
NAPSA MISSION shRNA Bacterial Glycerol Stock
napsin A aspartic peptidase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-1079s1c1
Sequence:CCGGCGTCATCCAGACTACTCGAAACTCGAGTTTCGAGTAGTCTGGATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-399s1c1
Sequence:CCGGTGCTGGTTACACCACCGATTTCTCGAGAAATCGGTGGTGTAACCAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-258s1c1
Sequence:CCGGCCTCTCTCGAACTACAGGGATCTCGAGATCCCTGTAGTTCGAGAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-683s1c1
Sequence:CCGGGCTATTGGATAAGCCTGTCTTCTCGAGAAGACAGGCTTATCCAATAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-515s1c1
Sequence:CCGGGCTGACTATTGGTGGAATCAACTCGAGTTGATTCCACCAATAGTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004851.1-129s21c1
Sequence:CCGGCTGATCCGCATCCCTCTTCATCTCGAGATGAAGAGGGATGCGGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004851.1-901s21c1
Sequence:CCGGATACGGGCACGTCCCTCATCACTCGAGTGATGAGGGACGTGCCCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004851.1-433s21c1
Sequence:CCGGCTAGCTCCTTCCAGGCCAATGCTCGAGCATTGGCCTGGAAGGAGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004851
NAPSA MISSION shRNA shRNA Plasmid DNA
napsin A aspartic peptidase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-1079s1c1
Sequence:CCGGCGTCATCCAGACTACTCGAAACTCGAGTTTCGAGTAGTCTGGATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-399s1c1
Sequence:CCGGTGCTGGTTACACCACCGATTTCTCGAGAAATCGGTGGTGTAACCAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-258s1c1
Sequence:CCGGCCTCTCTCGAACTACAGGGATCTCGAGATCCCTGTAGTTCGAGAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-683s1c1
Sequence:CCGGGCTATTGGATAAGCCTGTCTTCTCGAGAAGACAGGCTTATCCAATAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-515s1c1
Sequence:CCGGGCTGACTATTGGTGGAATCAACTCGAGTTGATTCCACCAATAGTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004851.1-129s21c1
Sequence:CCGGCTGATCCGCATCCCTCTTCATCTCGAGATGAAGAGGGATGCGGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004851.1-901s21c1
Sequence:CCGGATACGGGCACGTCCCTCATCACTCGAGTGATGAGGGACGTGCCCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004851.1-433s21c1
Sequence:CCGGCTAGCTCCTTCCAGGCCAATGCTCGAGCATTGGCCTGGAAGGAGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004851
NAPSA MISSION shRNA Lentiviral Transduction Particles
napsin A aspartic peptidase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-1079s1c1
Sequence:CCGGCGTCATCCAGACTACTCGAAACTCGAGTTTCGAGTAGTCTGGATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-399s1c1
Sequence:CCGGTGCTGGTTACACCACCGATTTCTCGAGAAATCGGTGGTGTAACCAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-258s1c1
Sequence:CCGGCCTCTCTCGAACTACAGGGATCTCGAGATCCCTGTAGTTCGAGAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-683s1c1
Sequence:CCGGGCTATTGGATAAGCCTGTCTTCTCGAGAAGACAGGCTTATCCAATAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004851.1-515s1c1
Sequence:CCGGGCTGACTATTGGTGGAATCAACTCGAGTTGATTCCACCAATAGTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004851.1-129s21c1
Sequence:CCGGCTGATCCGCATCCCTCTTCATCTCGAGATGAAGAGGGATGCGGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004851.1-901s21c1
Sequence:CCGGATACGGGCACGTCCCTCATCACTCGAGTGATGAGGGACGTGCCCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004851.1-433s21c1
Sequence:CCGGCTAGCTCCTTCCAGGCCAATGCTCGAGCATTGGCCTGGAAGGAGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)