EMAIL THIS PAGE TO A FRIEND

NARF

nuclear prelamin A recognition factor

106 Gene Product Result for
Synonyms: IOP2
UniProtKB ID: Q9UHQ1, A6NCJ3, B3KPX2, K4DI98, Q96AY9, Q9BWC6
Gene ID:
Human(26502) Summary: Several proteins have been found to be prenylated and methylated at their carboxyl-terminal ends. Prenylation was initially believed to be important only for membrane attachment. However, another role for prenylation appears to be its importance in protein-protein interactions. The only nuclear proteins known to be prenylated in mammalian cells are prelamin A- and B-type lamins. Prelamin A is farnesylated and carboxymethylated on the cysteine residue of a carboxyl-terminal CaaX motif. This post-translationally modified cysteine residue is removed from prelamin A when it is endoproteolytically processed into mature lamin A. The protein encoded by this gene binds to the prenylated prelamin A carboxyl-terminal tail domain. It may be a component of a prelamin A endoprotease complex. The encoded protein is located in the nucleus, where it partially colocalizes with the nuclear lamina. It shares limited sequence similarity with iron-only bacterial hydrogenases. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene, including one with a novel exon that is generated by RNA editing. [provided by RefSeq, Jul 2008]
Mouse(67608) nuclear prelamin A recognition factor
Rat(360681) nuclear prelamin A recognition factor
Zebrafish(436614) nuclear prelamin A recognition factor
chicken(417341) nuclear prelamin A recognition factor
cow(618340) nuclear prelamin A recognition factor
Horse(100056757) nuclear prelamin A recognition factor
domestic cat(101083050) nuclear prelamin A recognition factor
dog(480819) nuclear prelamin A recognition factor
sheep(101109463) nuclear prelamin A recognition factor
domestic guinea pig(100716616) nuclear prelamin A recognition factor
naked mole-rat(101707538) nuclear prelamin A recognition factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012336 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026272 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026272 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026272 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065361 MISSION® esiRNA esiRNA human NARF (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001038618 Rosetta Predictions human pricing
NM_001083608 Rosetta Predictions human pricing
NM_012336 Rosetta Predictions human pricing
NM_031968 Rosetta Predictions human pricing
NM_001039207 Rosetta Predictions rat pricing
XM_001081834 Rosetta Predictions rat pricing
NM_026272 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038618 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308396 predicted 1280
2 SASI_Hs02_00308397 predicted 1304
3 SASI_Hs02_00308398 predicted 1377
4 SASI_Hs01_00227497 predicted 1499
5 SASI_Hs02_00308399 predicted 1327
6 SASI_Hs02_00308400 predicted 1422
7 SASI_Hs02_00308401 predicted 1365
8 SASI_Hs02_00308402 predicted 1334
9 SASI_Hs02_00308403 predicted 810
10 SASI_Hs02_00308404 predicted 825
11 SASI_Hs01_00227489 predicted 1141
12 SASI_Hs01_00227490 predicted 624
13 SASI_Hs01_00227491 predicted 993
14 SASI_Hs01_00227492 predicted 1080
15 SASI_Hs01_00227493 predicted 893
16 SASI_Hs01_00227494 predicted 1059
17 SASI_Hs01_00227495 predicted 1409
18 SASI_Hs01_00227496 predicted 1241
19 SASI_Hs01_00227498 predicted 923
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083608 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317101 predicted 982
2 SASI_Hs02_00317102 predicted 1005
3 SASI_Hs02_00317103 predicted 1070
4 SASI_Hs02_00317104 predicted 1200
5 SASI_Hs02_00317105 predicted 1029
6 SASI_Hs02_00317106 predicted 1127
7 SASI_Hs02_00317107 predicted 1060
8 SASI_Hs02_00317108 predicted 1028
9 SASI_Hs02_00317109 predicted 505
10 SASI_Hs02_00317110 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344127 predicted 1118
2 SASI_Hs02_00344128 predicted 1144
3 SASI_Hs02_00344129 predicted 1215
4 SASI_Hs01_00053738 predicted 1345
5 SASI_Hs02_00344130 predicted 1174
6 SASI_Hs02_00344131 predicted 1265
7 SASI_Hs02_00344132 predicted 1212
8 SASI_Hs02_00344133 predicted 1174
9 SASI_Hs02_00344134 predicted 652
10 SASI_Hs02_00344135 predicted 665
11 SASI_Hs01_00053730 predicted 965
12 SASI_Hs01_00053731 predicted 438
13 SASI_Hs01_00053732 predicted 806
14 SASI_Hs01_00053733 predicted 901
15 SASI_Hs01_00053734 predicted 716
16 SASI_Hs01_00053735 predicted 881
17 SASI_Hs01_00053736 predicted 1230
18 SASI_Hs01_00053737 predicted 1062
19 SASI_Hs01_00053739 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359163 predicted 1259
2 SASI_Hs02_00359164 predicted 1279
3 SASI_Hs02_00359165 predicted 1360
4 SASI_Hs02_00359166 predicted 1474
5 SASI_Hs02_00359167 predicted 1308
6 SASI_Hs02_00359168 predicted 1405
7 SASI_Hs02_00359169 predicted 1350
8 SASI_Hs02_00359170 predicted 1317
9 SASI_Hs02_00359171 predicted 646
10 SASI_Hs02_00359172 predicted 659
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055098 predicted 853
2 SASI_Rn01_00055099 predicted 1122
3 SASI_Rn02_00204805 predicted 1170
4 SASI_Rn01_00055100 predicted 206
5 SASI_Rn01_00055102 predicted 480
6 SASI_Rn01_00055103 predicted 542
7 SASI_Rn01_00055104 predicted 423
8 SASI_Rn01_00055105 predicted 972
9 SASI_Rn01_00055106 predicted 347
10 SASI_Rn01_00055107 predicted 1053
11 SASI_Rn01_00055101 predicted 1141
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081834 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373722 predicted 453
2 SASI_Rn02_00373723 predicted 712
3 SASI_Rn02_00373724 predicted 711
4 SASI_Rn02_00373725 predicted 769
5 SASI_Rn02_00373726 predicted 392
6 SASI_Rn02_00373727 predicted 1039
7 SASI_Rn02_00373728 predicted 452
8 SASI_Rn02_00373729 predicted 565
9 SASI_Rn02_00373730 predicted 719
10 SASI_Rn02_00373731 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026272 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329962 predicted 223
2 SASI_Mm01_00032203 predicted 872
3 SASI_Mm01_00032204 predicted 867
4 SASI_Mm01_00032205 predicted 1185
5 SASI_Mm01_00032206 predicted 1076
6 SASI_Mm01_00032207 predicted 1458
7 SASI_Mm01_00032209 predicted 343
8 SASI_Mm01_00032210 predicted 505
9 SASI_Mm02_00329963 predicted 343
10 SASI_Mm01_00032211 predicted 916
11 SASI_Mm01_00032208 predicted 1301
12 SASI_Mm01_00032212 predicted 656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012336
VALIDATED
NARF MISSION shRNA Bacterial Glycerol Stock
nuclear prelamin A recognition factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-334s21c1
Sequence:CCGGGAGTCCAACTTTCCCAGCAAACTCGAGTTTGCTGGGAAAGTTGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-462s21c1
Sequence:CCGGGCTAAATTCAACCTCAGTGTACTCGAGTACACTGAGGTTGAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-1035s21c1
Sequence:CCGGCTGGCACACATCTTCAGACATCTCGAGATGTCTGAAGATGTGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-371s21c1
Sequence:CCGGCCGCGTTCTGAACCTTAACAACTCGAGTTGTTAAGGTTCAGAACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012336.2-339s1c1
Sequence:CCGGCCGCGTTCTGAACCTTAACAACTCGAGTTGTTAAGGTTCAGAACGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012336.2-1003s1c1
Sequence:CCGGCTGGCACACATCTTCAGACATCTCGAGATGTCTGAAGATGTGTGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012336.2-863s1c1
Sequence:CCGGGCGTGTTAACATCAGGTGAAACTCGAGTTTCACCTGATGTTAACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012336.2-430s1c1
Sequence:CCGGGCTAAATTCAACCTCAGTGTACTCGAGTACACTGAGGTTGAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012336.2-302s1c1
Sequence:CCGGGAGTCCAACTTTCCCAGCAAACTCGAGTTTGCTGGGAAAGTTGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-895s21c1
Sequence:CCGGGCGTGTTAACATCAGGTGAAACTCGAGTTTCACCTGATGTTAACACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012336
VALIDATED
NARF MISSION shRNA shRNA Plasmid DNA
nuclear prelamin A recognition factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-334s21c1
Sequence:CCGGGAGTCCAACTTTCCCAGCAAACTCGAGTTTGCTGGGAAAGTTGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-462s21c1
Sequence:CCGGGCTAAATTCAACCTCAGTGTACTCGAGTACACTGAGGTTGAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-1035s21c1
Sequence:CCGGCTGGCACACATCTTCAGACATCTCGAGATGTCTGAAGATGTGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-371s21c1
Sequence:CCGGCCGCGTTCTGAACCTTAACAACTCGAGTTGTTAAGGTTCAGAACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012336.2-339s1c1
Sequence:CCGGCCGCGTTCTGAACCTTAACAACTCGAGTTGTTAAGGTTCAGAACGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012336.2-1003s1c1
Sequence:CCGGCTGGCACACATCTTCAGACATCTCGAGATGTCTGAAGATGTGTGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012336.2-863s1c1
Sequence:CCGGGCGTGTTAACATCAGGTGAAACTCGAGTTTCACCTGATGTTAACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012336.2-430s1c1
Sequence:CCGGGCTAAATTCAACCTCAGTGTACTCGAGTACACTGAGGTTGAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012336.2-302s1c1
Sequence:CCGGGAGTCCAACTTTCCCAGCAAACTCGAGTTTGCTGGGAAAGTTGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000299814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-895s21c1
Sequence:CCGGGCGTGTTAACATCAGGTGAAACTCGAGTTTCACCTGATGTTAACACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012336
VALIDATED
NARF MISSION shRNA Lentiviral Transduction Particles
nuclear prelamin A recognition factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-334s21c1
Sequence:CCGGGAGTCCAACTTTCCCAGCAAACTCGAGTTTGCTGGGAAAGTTGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-462s21c1
Sequence:CCGGGCTAAATTCAACCTCAGTGTACTCGAGTACACTGAGGTTGAATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-1035s21c1
Sequence:CCGGCTGGCACACATCTTCAGACATCTCGAGATGTCTGAAGATGTGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-371s21c1
Sequence:CCGGCCGCGTTCTGAACCTTAACAACTCGAGTTGTTAAGGTTCAGAACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012336.2-339s1c1
Sequence:CCGGCCGCGTTCTGAACCTTAACAACTCGAGTTGTTAAGGTTCAGAACGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_012336.2-1003s1c1
Sequence:CCGGCTGGCACACATCTTCAGACATCTCGAGATGTCTGAAGATGTGTGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_012336.2-863s1c1
Sequence:CCGGGCGTGTTAACATCAGGTGAAACTCGAGTTTCACCTGATGTTAACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_012336.2-430s1c1
Sequence:CCGGGCTAAATTCAACCTCAGTGTACTCGAGTACACTGAGGTTGAATTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012336.2-302s1c1
Sequence:CCGGGAGTCCAACTTTCCCAGCAAACTCGAGTTTGCTGGGAAAGTTGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000299814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012336.3-895s21c1
Sequence:CCGGGCGTGTTAACATCAGGTGAAACTCGAGTTTCACCTGATGTTAACACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026272
VALIDATED
NARF MISSION shRNA Bacterial Glycerol Stock
nuclear prelamin A recognition factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.2-1281s1c1
Sequence:CCGGGCAGCAAATGGAAGGGATCTACTCGAGTAGATCCCTTCCATTTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026272.2-2260s1c1
Sequence:CCGGCCCTGCATTTGATGCAATGTACTCGAGTACATTGCATCAAATGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.2-1057s1c1
Sequence:CCGGCTCAGGAACAAAGACTTCCATCTCGAGATGGAAGTCTTTGTTCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.3-921s1c1
Sequence:CCGGGACATTGCTGTGGATACTTTGCTCGAGCAAAGTATCCACAGCAATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.3-403s1c1
Sequence:CCGGGTCCTCAGTCTCTACCTTATTCTCGAGAATAAGGTAGAGACTGAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026272.3-404s21c1
Sequence:CCGGTCCTCAGTCTCTACCTTATTTCTCGAGAAATAAGGTAGAGACTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-921s21c1
Sequence:CCGGGACATTGCTGTGGATACTTTGCTCGAGCAAAGTATCCACAGCAATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-819s21c1
Sequence:CCGGGAGGGACTTTCCACTACTTTACTCGAGTAAAGTAGTGGAAAGTCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-1144s21c1
Sequence:CCGGCGTACGGCTTTCGCAACATTCCTCGAGGAATGTTGCGAAAGCCGTACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-2118s21c1
Sequence:CCGGTAGTAACAGTGAGCCATATTTCTCGAGAAATATGGCTCACTGTTACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026272
VALIDATED
NARF MISSION shRNA shRNA Plasmid DNA
nuclear prelamin A recognition factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.2-1281s1c1
Sequence:CCGGGCAGCAAATGGAAGGGATCTACTCGAGTAGATCCCTTCCATTTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026272.2-2260s1c1
Sequence:CCGGCCCTGCATTTGATGCAATGTACTCGAGTACATTGCATCAAATGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.2-1057s1c1
Sequence:CCGGCTCAGGAACAAAGACTTCCATCTCGAGATGGAAGTCTTTGTTCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.3-921s1c1
Sequence:CCGGGACATTGCTGTGGATACTTTGCTCGAGCAAAGTATCCACAGCAATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.3-403s1c1
Sequence:CCGGGTCCTCAGTCTCTACCTTATTCTCGAGAATAAGGTAGAGACTGAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026272.3-404s21c1
Sequence:CCGGTCCTCAGTCTCTACCTTATTTCTCGAGAAATAAGGTAGAGACTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-921s21c1
Sequence:CCGGGACATTGCTGTGGATACTTTGCTCGAGCAAAGTATCCACAGCAATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-819s21c1
Sequence:CCGGGAGGGACTTTCCACTACTTTACTCGAGTAAAGTAGTGGAAAGTCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-1144s21c1
Sequence:CCGGCGTACGGCTTTCGCAACATTCCTCGAGGAATGTTGCGAAAGCCGTACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-2118s21c1
Sequence:CCGGTAGTAACAGTGAGCCATATTTCTCGAGAAATATGGCTCACTGTTACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026272
VALIDATED
NARF MISSION shRNA Lentiviral Transduction Particles
nuclear prelamin A recognition factor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.2-1281s1c1
Sequence:CCGGGCAGCAAATGGAAGGGATCTACTCGAGTAGATCCCTTCCATTTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026272.2-2260s1c1
Sequence:CCGGCCCTGCATTTGATGCAATGTACTCGAGTACATTGCATCAAATGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.2-1057s1c1
Sequence:CCGGCTCAGGAACAAAGACTTCCATCTCGAGATGGAAGTCTTTGTTCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.3-921s1c1
Sequence:CCGGGACATTGCTGTGGATACTTTGCTCGAGCAAAGTATCCACAGCAATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026272.3-403s1c1
Sequence:CCGGGTCCTCAGTCTCTACCTTATTCTCGAGAATAAGGTAGAGACTGAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026272.3-404s21c1
Sequence:CCGGTCCTCAGTCTCTACCTTATTTCTCGAGAAATAAGGTAGAGACTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-921s21c1
Sequence:CCGGGACATTGCTGTGGATACTTTGCTCGAGCAAAGTATCCACAGCAATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-819s21c1
Sequence:CCGGGAGGGACTTTCCACTACTTTACTCGAGTAAAGTAGTGGAAAGTCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-1144s21c1
Sequence:CCGGCGTACGGCTTTCGCAACATTCCTCGAGGAATGTTGCGAAAGCCGTACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249216    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026272.3-2118s21c1
Sequence:CCGGTAGTAACAGTGAGCCATATTTCTCGAGAAATATGGCTCACTGTTACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)