EMAIL THIS PAGE TO A FRIEND

NARFL

nuclear prelamin A recognition factor-like

55 Gene Product Result for
Synonyms: HPRN IOP1 LET1L PRN
UniProtKB ID: Q9H6Q4, A1L385, B3KTJ3, Q53GC6, Q96S10, Q9H6J8
Gene ID:
Mouse(67563) nuclear prelamin A recognition factor-like
Rat(360496) nuclear prelamin A recognition factor-like
Zebrafish(560541) nuclear prelamin A recognition factor-like
cow(511837) nuclear prelamin A recognition factor-like
domestic cat(101087289) nuclear prelamin A recognition factor-like
dog(490086) nuclear prelamin A recognition factor-like
chicken(416535) nuclear prelamin A recognition factor-like
naked mole-rat(101705306) nuclear prelamin A recognition factor-like
domestic guinea pig(100718443) nuclear prelamin A recognition factor-like
sheep(101104879) nuclear prelamin A recognition factor-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026238 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026238 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026238 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022493 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022493 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022493 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022493 Rosetta Predictions human pricing
NM_001013183 Rosetta Predictions rat pricing
NM_026238 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079459 predicted 1368
2 SASI_Hs01_00079460 predicted 1554
3 SASI_Hs01_00079461 predicted 334
4 SASI_Hs01_00079462 predicted 410
5 SASI_Hs01_00079464 predicted 197
6 SASI_Hs02_00355806 predicted 409
7 SASI_Hs02_00355807 predicted 257
8 SASI_Hs01_00079466 predicted 712
9 SASI_Hs01_00079467 predicted 328
10 SASI_Hs01_00079468 predicted 727
11 SASI_Hs01_00079463 predicted 392
12 SASI_Hs01_00079465 predicted 298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046301 predicted 647
2 SASI_Rn01_00046304 predicted 702
3 SASI_Rn01_00046305 predicted 278
4 SASI_Rn01_00046306 predicted 1713
5 SASI_Rn01_00046307 predicted 810
6 SASI_Rn01_00046308 predicted 582
7 SASI_Rn01_00046309 predicted 488
8 SASI_Rn02_00200941 predicted 703
9 SASI_Rn01_00046310 predicted 883
10 SASI_Rn02_00200942 predicted 721
11 SASI_Rn01_00046302 predicted 647
12 SASI_Rn01_00046303 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026238 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092600 predicted 1037
2 SASI_Mm01_00092601 predicted 673
3 SASI_Mm01_00092602 predicted 1187
4 SASI_Mm01_00092603 predicted 725
5 SASI_Mm01_00092604 predicted 1175
6 SASI_Mm01_00092606 predicted 827
7 SASI_Mm01_00092607 predicted 304
8 SASI_Mm01_00092608 predicted 718
9 SASI_Mm01_00092609 predicted 602
10 SASI_Mm02_00329920 predicted 907
11 SASI_Mm01_00092605 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026238
NARFL MISSION shRNA Bacterial Glycerol Stock
nuclear prelamin A recognition factor-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-307s21c1
Sequence:CCGGGAAGGTTCTAGATGCTAATAACTCGAGTTATTAGCATCTAGAACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026238.3-88s1c1
Sequence:CCGGGAATTGCATCAAGCCTGTAAACTCGAGTTTACAGGCTTGATGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026238.2-836s1c1
Sequence:CCGGCCTTACAACAGGAGAAGTCTTCTCGAGAAGACTTCTCCTGTTGTAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026238.3-1180s1c1
Sequence:CCGGCTACCATTACGTGGAAGTAATCTCGAGATTACTTCCACGTAATGGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-1120s21c1
Sequence:CCGGGGCCTATGGTTTCCGTAATATCTCGAGATATTACGGAAACCATAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-88s21c1
Sequence:CCGGGAATTGCATCAAGCCTGTAAACTCGAGTTTACAGGCTTGATGCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-749s21c1
Sequence:CCGGGTGATGCCCTGCTATGATAAACTCGAGTTTATCATAGCAGGGCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026238
NARFL MISSION shRNA shRNA Plasmid DNA
nuclear prelamin A recognition factor-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-307s21c1
Sequence:CCGGGAAGGTTCTAGATGCTAATAACTCGAGTTATTAGCATCTAGAACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026238.3-88s1c1
Sequence:CCGGGAATTGCATCAAGCCTGTAAACTCGAGTTTACAGGCTTGATGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026238.2-836s1c1
Sequence:CCGGCCTTACAACAGGAGAAGTCTTCTCGAGAAGACTTCTCCTGTTGTAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026238.3-1180s1c1
Sequence:CCGGCTACCATTACGTGGAAGTAATCTCGAGATTACTTCCACGTAATGGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000258138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-1120s21c1
Sequence:CCGGGGCCTATGGTTTCCGTAATATCTCGAGATATTACGGAAACCATAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-88s21c1
Sequence:CCGGGAATTGCATCAAGCCTGTAAACTCGAGTTTACAGGCTTGATGCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-749s21c1
Sequence:CCGGGTGATGCCCTGCTATGATAAACTCGAGTTTATCATAGCAGGGCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026238
NARFL MISSION shRNA Lentiviral Transduction Particles
nuclear prelamin A recognition factor-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-307s21c1
Sequence:CCGGGAAGGTTCTAGATGCTAATAACTCGAGTTATTAGCATCTAGAACCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026238.3-88s1c1
Sequence:CCGGGAATTGCATCAAGCCTGTAAACTCGAGTTTACAGGCTTGATGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026238.2-836s1c1
Sequence:CCGGCCTTACAACAGGAGAAGTCTTCTCGAGAAGACTTCTCCTGTTGTAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026238.3-1180s1c1
Sequence:CCGGCTACCATTACGTGGAAGTAATCTCGAGATTACTTCCACGTAATGGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000258138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-1120s21c1
Sequence:CCGGGGCCTATGGTTTCCGTAATATCTCGAGATATTACGGAAACCATAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-88s21c1
Sequence:CCGGGAATTGCATCAAGCCTGTAAACTCGAGTTTACAGGCTTGATGCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026238.3-749s21c1
Sequence:CCGGGTGATGCCCTGCTATGATAAACTCGAGTTTATCATAGCAGGGCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022493
NARFL MISSION shRNA Bacterial Glycerol Stock
nuclear prelamin A recognition factor-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-127s1c1
Sequence:CCGGGCCAAGATTCGCATTGAAGATCTCGAGATCTTCAATGCGAATCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022493.1-1377s21c1
Sequence:CCGGTCGCTTGCTGCATACGCAGTACTCGAGTACTGCGTATGCAGCAAGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022493.1-198s21c1
Sequence:CCGGGAAGGCCAAGGTCTCGCTAAACTCGAGTTTAGCGAGACCTTGGCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022493.1-149s21c1
Sequence:CCGGACGGGAGCTACTTCCAAATTACTCGAGTAATTTGGAAGTAGCTCCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-297s1c1
Sequence:CCGGGAAGGTTCTAGATGCTAACAACTCGAGTTGTTAGCATCTAGAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-416s1c1
Sequence:CCGGCTGCCAGGAAATTAACCTCATCTCGAGATGAGGTTAATTTCCTGGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-289s1c1
Sequence:CCGGGAGCTGAAGAAGGTTCTAGATCTCGAGATCTAGAACCTTCTTCAGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-419s1c1
Sequence:CCGGCCAGGAAATTAACCTCATTCTCTCGAGAGAATGAGGTTAATTTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022493
NARFL MISSION shRNA shRNA Plasmid DNA
nuclear prelamin A recognition factor-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-127s1c1
Sequence:CCGGGCCAAGATTCGCATTGAAGATCTCGAGATCTTCAATGCGAATCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022493.1-1377s21c1
Sequence:CCGGTCGCTTGCTGCATACGCAGTACTCGAGTACTGCGTATGCAGCAAGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022493.1-198s21c1
Sequence:CCGGGAAGGCCAAGGTCTCGCTAAACTCGAGTTTAGCGAGACCTTGGCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022493.1-149s21c1
Sequence:CCGGACGGGAGCTACTTCCAAATTACTCGAGTAATTTGGAAGTAGCTCCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-297s1c1
Sequence:CCGGGAAGGTTCTAGATGCTAACAACTCGAGTTGTTAGCATCTAGAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-416s1c1
Sequence:CCGGCTGCCAGGAAATTAACCTCATCTCGAGATGAGGTTAATTTCCTGGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-289s1c1
Sequence:CCGGGAGCTGAAGAAGGTTCTAGATCTCGAGATCTAGAACCTTCTTCAGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-419s1c1
Sequence:CCGGCCAGGAAATTAACCTCATTCTCTCGAGAGAATGAGGTTAATTTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022493
NARFL MISSION shRNA Lentiviral Transduction Particles
nuclear prelamin A recognition factor-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-127s1c1
Sequence:CCGGGCCAAGATTCGCATTGAAGATCTCGAGATCTTCAATGCGAATCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022493.1-1377s21c1
Sequence:CCGGTCGCTTGCTGCATACGCAGTACTCGAGTACTGCGTATGCAGCAAGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022493.1-198s21c1
Sequence:CCGGGAAGGCCAAGGTCTCGCTAAACTCGAGTTTAGCGAGACCTTGGCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022493.1-149s21c1
Sequence:CCGGACGGGAGCTACTTCCAAATTACTCGAGTAATTTGGAAGTAGCTCCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-297s1c1
Sequence:CCGGGAAGGTTCTAGATGCTAACAACTCGAGTTGTTAGCATCTAGAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-416s1c1
Sequence:CCGGCTGCCAGGAAATTAACCTCATCTCGAGATGAGGTTAATTTCCTGGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-289s1c1
Sequence:CCGGGAGCTGAAGAAGGTTCTAGATCTCGAGATCTAGAACCTTCTTCAGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022493.1-419s1c1
Sequence:CCGGCCAGGAAATTAACCTCATTCTCTCGAGAGAATGAGGTTAATTTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)