EMAIL THIS PAGE TO A FRIEND

NARG2

NMDA receptor regulated 2

244 Gene Product Result for
Synonyms: BRCC1
Gene ID:
Mouse(93697) NMDA receptor-regulated gene 2
Rat(691379) NMDA receptor regulated 2
sheep(101113762) NMDA receptor regulated 2
domestic guinea pig(100725440) NMDA receptor regulated 2
naked mole-rat(101722591) NMDA receptor regulated 2
Domestic Rabbit(100354629) NMDA receptor regulated 2
Zebrafish(100005372) NMDA receptor regulated 2
chicken(415378) NMDA receptor regulated 2
cow(541255) NMDA receptor regulated 2
Horse(100054271) NMDA receptor regulated 2
domestic cat(101092767) NMDA receptor regulated 2
dog(608993) NMDA receptor regulated 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
A3903 1-Aminocyclopropanecarboxylic acid ≥98% (TLC) human, mouse, rat pricing
C8005 D-Cysteine hydrochloride monohydrate ≥98% (TLC) human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145618 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145618 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145618 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001018089 Rosetta Predictions human pricing
NM_024611 Rosetta Predictions human pricing
XM_001075476 Rosetta Predictions rat pricing
XM_001075498 Rosetta Predictions rat pricing
NM_145618 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138834 predicted 916
2 SASI_Hs02_00306999 predicted 1596
3 SASI_Hs01_00138836 predicted 2116
4 SASI_Hs01_00138837 predicted 1567
5 SASI_Hs01_00138838 predicted 2672
6 SASI_Hs01_00138839 predicted 2714
7 SASI_Hs01_00138840 predicted 1925
8 SASI_Hs01_00138843 predicted 1164
9 SASI_Hs02_00307000 predicted 2795
10 SASI_Hs02_00307001 predicted 877
11 SASI_Hs01_00138835 predicted 2216
12 SASI_Hs01_00138841 predicted 1301
13 SASI_Hs01_00138842 predicted 1341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116500 predicted 1076
2 SASI_Hs02_00356974 predicted 1755
3 SASI_Hs01_00116502 predicted 2270
4 SASI_Hs01_00116503 predicted 1727
5 SASI_Hs01_00116504 predicted 2831
6 SASI_Hs01_00116505 predicted 2868
7 SASI_Hs01_00116506 predicted 2088
8 SASI_Hs01_00116509 predicted 1326
9 SASI_Hs02_00356975 predicted 2955
10 SASI_Hs02_00356976 predicted 1038
11 SASI_Hs01_00116501 predicted 2379
12 SASI_Hs01_00116507 predicted 1452
13 SASI_Hs01_00116508 predicted 1500
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349884 predicted 615
2 SASI_Rn02_00349885 predicted 3372
3 SASI_Rn02_00349886 predicted 917
4 SASI_Rn02_00349887 predicted 3351
5 SASI_Rn02_00349888 predicted 1066
6 SASI_Rn02_00349889 predicted 1024
7 SASI_Rn02_00349890 predicted 997
8 SASI_Rn02_00349891 predicted 763
9 SASI_Rn02_00349892 predicted 1086
10 SASI_Rn02_00349893 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075498 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349974 predicted 767
2 SASI_Rn02_00349975 predicted 3520
3 SASI_Rn02_00349976 predicted 1062
4 SASI_Rn02_00349977 predicted 3499
5 SASI_Rn02_00349978 predicted 1212
6 SASI_Rn02_00349979 predicted 1171
7 SASI_Rn02_00349980 predicted 1140
8 SASI_Rn02_00349981 predicted 911
9 SASI_Rn02_00349982 predicted 1236
10 SASI_Rn02_00349983 predicted 1163
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117451 predicted 2806
2 SASI_Mm01_00117452 predicted 1320
3 SASI_Mm01_00117453 predicted 1577
4 SASI_Mm01_00117454 predicted 2558
5 SASI_Mm01_00117455 predicted 982
6 SASI_Mm01_00117456 predicted 1932
7 SASI_Mm01_00117457 predicted 1025
8 SASI_Mm01_00117459 predicted 2902
9 SASI_Mm01_00117460 predicted 2314
10 SASI_Mm02_00341192 predicted 615
11 SASI_Mm01_00117458 predicted 2519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145618
VALIDATED
NARG2 MISSION shRNA Bacterial Glycerol Stock
NMDA receptor regulated 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145618.3-2911s21c1
Sequence:CCGGTTACCTGTTACCATATCATATCTCGAGATATGATATGGTAACAGGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145618.3-2815s21c1
Sequence:CCGGAGTTACTAGAACGGCATATAACTCGAGTTATATGCCGTTCTAGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145618.3-1568s21c1
Sequence:CCGGGCTACACCTAACATTACTGATCTCGAGATCAGTAATGTTAGGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145618.3-457s21c1
Sequence:CCGGGCAGAGAACTTATGTGGATTTCTCGAGAAATCCACATAAGTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145618.3-3158s21c1
Sequence:CCGGCCCAGTTATAACAGTGTTTAACTCGAGTTAAACACTGTTATAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145618.3-3158s1c1
Sequence:CCGGCCCAGTTATAACAGTGTTTAACTCGAGTTAAACACTGTTATAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145618.3-457s1c1
Sequence:CCGGGCAGAGAACTTATGTGGATTTCTCGAGAAATCCACATAAGTTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145618.3-2268s1c1
Sequence:CCGGCCTCTGCATTTCAGAAGCCTACTCGAGTAGGCTTCTGAAATGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145618.3-1568s1c1
Sequence:CCGGGCTACACCTAACATTACTGATCTCGAGATCAGTAATGTTAGGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145618.3-2906s1c1
Sequence:CCGGCCCAGTTACCTGTTACCATATCTCGAGATATGGTAACAGGTAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145618
VALIDATED
NARG2 MISSION shRNA shRNA Plasmid DNA
NMDA receptor regulated 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145618.3-2911s21c1
Sequence:CCGGTTACCTGTTACCATATCATATCTCGAGATATGATATGGTAACAGGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145618.3-2815s21c1
Sequence:CCGGAGTTACTAGAACGGCATATAACTCGAGTTATATGCCGTTCTAGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145618.3-1568s21c1
Sequence:CCGGGCTACACCTAACATTACTGATCTCGAGATCAGTAATGTTAGGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145618.3-457s21c1
Sequence:CCGGGCAGAGAACTTATGTGGATTTCTCGAGAAATCCACATAAGTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145618.3-3158s21c1
Sequence:CCGGCCCAGTTATAACAGTGTTTAACTCGAGTTAAACACTGTTATAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145618.3-3158s1c1
Sequence:CCGGCCCAGTTATAACAGTGTTTAACTCGAGTTAAACACTGTTATAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145618.3-457s1c1
Sequence:CCGGGCAGAGAACTTATGTGGATTTCTCGAGAAATCCACATAAGTTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145618.3-2268s1c1
Sequence:CCGGCCTCTGCATTTCAGAAGCCTACTCGAGTAGGCTTCTGAAATGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145618.3-1568s1c1
Sequence:CCGGGCTACACCTAACATTACTGATCTCGAGATCAGTAATGTTAGGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000125806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145618.3-2906s1c1
Sequence:CCGGCCCAGTTACCTGTTACCATATCTCGAGATATGGTAACAGGTAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145618
VALIDATED
NARG2 MISSION shRNA Lentiviral Transduction Particles
NMDA receptor regulated 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145618.3-2911s21c1
Sequence:CCGGTTACCTGTTACCATATCATATCTCGAGATATGATATGGTAACAGGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145618.3-2815s21c1
Sequence:CCGGAGTTACTAGAACGGCATATAACTCGAGTTATATGCCGTTCTAGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145618.3-1568s21c1
Sequence:CCGGGCTACACCTAACATTACTGATCTCGAGATCAGTAATGTTAGGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145618.3-457s21c1
Sequence:CCGGGCAGAGAACTTATGTGGATTTCTCGAGAAATCCACATAAGTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_145618.3-3158s21c1
Sequence:CCGGCCCAGTTATAACAGTGTTTAACTCGAGTTAAACACTGTTATAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125804    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145618.3-3158s1c1
Sequence:CCGGCCCAGTTATAACAGTGTTTAACTCGAGTTAAACACTGTTATAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145618.3-457s1c1
Sequence:CCGGGCAGAGAACTTATGTGGATTTCTCGAGAAATCCACATAAGTTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145618.3-2268s1c1
Sequence:CCGGCCTCTGCATTTCAGAAGCCTACTCGAGTAGGCTTCTGAAATGCAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145618.3-1568s1c1
Sequence:CCGGGCTACACCTAACATTACTGATCTCGAGATCAGTAATGTTAGGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000125806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_145618.3-2906s1c1
Sequence:CCGGCCCAGTTACCTGTTACCATATCTCGAGATATGGTAACAGGTAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024611
NARG2 MISSION shRNA Bacterial Glycerol Stock
NMDA receptor regulated 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-333s1c1
Sequence:CCGGCCAACAGACGTATAGGAGAAACTCGAGTTTCTCCTATACGTCTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-2546s1c1
Sequence:CCGGGCTCTGACTGAAAGTGAACTTCTCGAGAAGTTCACTTTCAGTCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3536s1c1
Sequence:CCGGGCCACTGCTGAAGATGATTATCTCGAGATAATCATCTTCAGCAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-1529s1c1
Sequence:CCGGGCACCAGACATTTCTGCTAATCTCGAGATTAGCAGAAATGTCTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-3089s1c1
Sequence:CCGGGCTCAGCAAGTTGAAACTGAACTCGAGTTCAGTTTCAACTTGCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3548s1c1
Sequence:CCGGGATGATTATGAGCATCGCAAACTCGAGTTTGCGATGCTCATAATCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-734s1c1
Sequence:CCGGGCTTGCATTGAACAAGTGAAACTCGAGTTTCACTTGTTCAATGCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3542s1c1
Sequence:CCGGGCTGAAGATGATTATGAGCATCTCGAGATGCTCATAATCATCTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-1802s1c1
Sequence:CCGGGCTGATGGTGAAAGACCTAATCTCGAGATTAGGTCTTTCACCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024611.3-932s1c1
Sequence:CCGGGCTACCATTGAAACGTCAGAACTCGAGTTCTGACGTTTCAATGGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3327s1c1
Sequence:CCGGCCCTTAAAGTTTGAGGAGGATCTCGAGATCCTCCTCAAACTTTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-3043s1c1
Sequence:CCGGCCACAGGAATCCAGTTTCCATCTCGAGATGGAAACTGGATTCCTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-505s1c1
Sequence:CCGGGCAGAGGAGTTATGTGGACTTCTCGAGAAGTCCACATAACTCCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-1995s1c1
Sequence:CCGGCCAGACCAGCTAGTCCAAATTCTCGAGAATTTGGACTAGCTGGTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024611
NARG2 MISSION shRNA shRNA Plasmid DNA
NMDA receptor regulated 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-333s1c1
Sequence:CCGGCCAACAGACGTATAGGAGAAACTCGAGTTTCTCCTATACGTCTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-2546s1c1
Sequence:CCGGGCTCTGACTGAAAGTGAACTTCTCGAGAAGTTCACTTTCAGTCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3536s1c1
Sequence:CCGGGCCACTGCTGAAGATGATTATCTCGAGATAATCATCTTCAGCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-1529s1c1
Sequence:CCGGGCACCAGACATTTCTGCTAATCTCGAGATTAGCAGAAATGTCTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-3089s1c1
Sequence:CCGGGCTCAGCAAGTTGAAACTGAACTCGAGTTCAGTTTCAACTTGCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3548s1c1
Sequence:CCGGGATGATTATGAGCATCGCAAACTCGAGTTTGCGATGCTCATAATCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-734s1c1
Sequence:CCGGGCTTGCATTGAACAAGTGAAACTCGAGTTTCACTTGTTCAATGCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3542s1c1
Sequence:CCGGGCTGAAGATGATTATGAGCATCTCGAGATGCTCATAATCATCTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-1802s1c1
Sequence:CCGGGCTGATGGTGAAAGACCTAATCTCGAGATTAGGTCTTTCACCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024611.3-932s1c1
Sequence:CCGGGCTACCATTGAAACGTCAGAACTCGAGTTCTGACGTTTCAATGGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3327s1c1
Sequence:CCGGCCCTTAAAGTTTGAGGAGGATCTCGAGATCCTCCTCAAACTTTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-3043s1c1
Sequence:CCGGCCACAGGAATCCAGTTTCCATCTCGAGATGGAAACTGGATTCCTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-505s1c1
Sequence:CCGGGCAGAGGAGTTATGTGGACTTCTCGAGAAGTCCACATAACTCCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-1995s1c1
Sequence:CCGGCCAGACCAGCTAGTCCAAATTCTCGAGAATTTGGACTAGCTGGTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024611
NARG2 MISSION shRNA Lentiviral Transduction Particles
NMDA receptor regulated 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153903    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-333s1c1
Sequence:CCGGCCAACAGACGTATAGGAGAAACTCGAGTTTCTCCTATACGTCTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153322    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-2546s1c1
Sequence:CCGGGCTCTGACTGAAAGTGAACTTCTCGAGAAGTTCACTTTCAGTCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3536s1c1
Sequence:CCGGGCCACTGCTGAAGATGATTATCTCGAGATAATCATCTTCAGCAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-1529s1c1
Sequence:CCGGGCACCAGACATTTCTGCTAATCTCGAGATTAGCAGAAATGTCTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-3089s1c1
Sequence:CCGGGCTCAGCAAGTTGAAACTGAACTCGAGTTCAGTTTCAACTTGCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150506    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3548s1c1
Sequence:CCGGGATGATTATGAGCATCGCAAACTCGAGTTTGCGATGCTCATAATCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-734s1c1
Sequence:CCGGGCTTGCATTGAACAAGTGAAACTCGAGTTTCACTTGTTCAATGCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3542s1c1
Sequence:CCGGGCTGAAGATGATTATGAGCATCTCGAGATGCTCATAATCATCTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-1802s1c1
Sequence:CCGGGCTGATGGTGAAAGACCTAATCTCGAGATTAGGTCTTTCACCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024611.3-932s1c1
Sequence:CCGGGCTACCATTGAAACGTCAGAACTCGAGTTCTGACGTTTCAATGGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024611.3-3327s1c1
Sequence:CCGGCCCTTAAAGTTTGAGGAGGATCTCGAGATCCTCCTCAAACTTTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158028    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-3043s1c1
Sequence:CCGGCCACAGGAATCCAGTTTCCATCTCGAGATGGAAACTGGATTCCTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-505s1c1
Sequence:CCGGGCAGAGGAGTTATGTGGACTTCTCGAGAAGTCCACATAACTCCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157640    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024611.3-1995s1c1
Sequence:CCGGCCAGACCAGCTAGTCCAAATTCTCGAGAATTTGGACTAGCTGGTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)