EMAIL THIS PAGE TO A FRIEND

NASP

nuclear autoantigenic sperm protein (histone-binding)

111 Gene Product Result for
Synonyms: FLB7527 PRO1999
Gene ID:
Human(4678) Summary: This gene encodes a H1 histone binding protein that is involved in transporting histones into the nucleus of dividing cells. Multiple isoforms are encoded by transcript variants of this gene. The somatic form is expressed in all mitotic cells, is localized to the nucleus, and is coupled to the cell cycle. The testicular form is expressed in embryonic tissues, tumor cells, and the testis. In male germ cells, this protein is localized to the cytoplasm of primary spermatocytes, the nucleus of spermatids, and the periacrosomal region of mature spermatozoa. [provided by RefSeq, Jul 2008]
Mouse(50927) nuclear autoantigenic sperm protein (histone-binding)
Rat(298441) nuclear autoantigenic sperm protein (histone-binding)
sheep(101121892) nuclear autoantigenic sperm protein (histone-binding)
domestic guinea pig(100722773) nuclear autoantigenic sperm protein (histone-binding)
naked mole-rat(101712170) nuclear autoantigenic sperm protein (histone-binding)
Domestic Rabbit(100009592) nuclear autoantigenic sperm protein (histone-binding)
Zebrafish(799570) nuclear autoantigenic sperm protein (histone-binding)
dog(475373) nuclear autoantigenic sperm protein (histone-binding)
Horse(100052307) nuclear autoantigenic sperm protein (histone-binding)
cow(512427) nuclear autoantigenic sperm protein (histone-binding)
domestic cat(101091715) nuclear autoantigenic sperm protein (histone-binding)
chicken(424600) nuclear autoantigenic sperm protein (histone-binding)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172164 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016777 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016777 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016777 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093991 MISSION® esiRNA esiRNA human NASP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002482 Rosetta Predictions human pricing
NM_152298 Rosetta Predictions human pricing
NM_172164 Rosetta Predictions human pricing
NM_001005543 Rosetta Predictions rat pricing
NM_001081475 Rosetta Predictions mouse pricing
NM_016777 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218469 predicted 1912
2 SASI_Hs01_00218470 predicted 2217
3 SASI_Hs01_00218472 predicted 1985
4 SASI_Hs02_00333913 predicted 2212
5 SASI_Hs01_00218473 predicted 1927
6 SASI_Hs01_00218474 predicted 2167
7 SASI_Hs01_00218477 predicted 1872
8 SASI_Hs02_00333914 predicted 1881
9 SASI_Hs01_00218478 predicted 2349
10 SASI_Hs02_00333915 predicted 1728
11 SASI_Hs01_00218471 predicted 1922
12 SASI_Hs01_00218475 predicted 2233
13 SASI_Hs01_00218476 predicted 1883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152298 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144579 predicted 894
2 SASI_Hs01_00144580 predicted 1192
3 SASI_Hs01_00144582 predicted 967
4 SASI_Hs02_00365863 predicted 1195
5 SASI_Hs01_00144583 predicted 913
6 SASI_Hs01_00144584 predicted 1157
7 SASI_Hs01_00144587 predicted 854
8 SASI_Hs02_00365864 predicted 867
9 SASI_Hs01_00144588 predicted 1335
10 SASI_Hs02_00365865 predicted 708
11 SASI_Hs01_00144581 predicted 904
12 SASI_Hs01_00144585 predicted 1214
13 SASI_Hs01_00144586 predicted 866
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143737 predicted 1986
2 SASI_Hs01_00143738 predicted 2291
3 SASI_Hs01_00143740 predicted 2055
4 SASI_Hs02_00367859 predicted 2280
5 SASI_Hs01_00143741 predicted 2001
6 SASI_Hs01_00143742 predicted 2249
7 SASI_Hs01_00143745 predicted 1948
8 SASI_Hs02_00367860 predicted 1949
9 SASI_Hs01_00143746 predicted 2426
10 SASI_Hs02_00367861 predicted 1802
11 SASI_Hs01_00143739 predicted 1994
12 SASI_Hs01_00143743 predicted 2300
13 SASI_Hs01_00143744 predicted 1961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005543 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073247 predicted 753
2 SASI_Rn02_00198398 predicted 1019
3 SASI_Rn01_00073250 predicted 1509
4 SASI_Rn01_00073251 predicted 532
5 SASI_Rn01_00073252 predicted 583
6 SASI_Rn02_00198399 predicted 761
7 SASI_Rn01_00073253 predicted 1160
8 SASI_Rn01_00073254 predicted 1289
9 SASI_Rn01_00073255 predicted 568
10 SASI_Rn02_00198400 predicted 982
11 SASI_Rn01_00073246 predicted 336
12 SASI_Rn01_00073248 predicted 2202
13 SASI_Rn01_00073249 predicted 1884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298580 predicted 271
2 SASI_Mm02_00298581 predicted 1024
3 SASI_Mm02_00298582 predicted 771
4 SASI_Mm02_00298583 predicted 974
5 SASI_Mm02_00298584 predicted 840
6 SASI_Mm02_00298585 predicted 1193
7 SASI_Mm02_00298586 predicted 272
8 SASI_Mm02_00298587 predicted 911
9 SASI_Mm02_00298588 predicted 905
10 SASI_Mm02_00298589 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016777 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054041 predicted 267
2 SASI_Mm02_00323546 predicted 1993
3 SASI_Mm02_00323547 predicted 1740
4 SASI_Mm01_00054044 predicted 1940
5 SASI_Mm01_00054046 predicted 1807
6 SASI_Mm02_00323548 predicted 2170
7 SASI_Mm02_00323549 predicted 274
8 SASI_Mm02_00323550 predicted 1877
9 SASI_Mm02_00323551 predicted 1880
10 SASI_Mm01_00054048 predicted 1897
11 SASI_Mm01_00054042 predicted 951
12 SASI_Mm01_00054043 predicted 1059
13 SASI_Mm01_00054045 predicted 1216
14 SASI_Mm01_00054047 predicted 675
15 SASI_Mm01_00054049 predicted 1201
16 SASI_Mm01_00054050 predicted 1165
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172164
VALIDATED
NASP MISSION shRNA Bacterial Glycerol Stock
nuclear autoantigenic sperm protein (histone-binding)
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_172164.1-956s21c1
Sequence:CCGGGAGAAGCAGGGAGAGGTAATTCTCGAGAATTACCTCTCCCTGCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172164.1-3032s1c1
Sequence:CCGGGCTATAATTCTGTCCTGGAAACTCGAGTTTCCAGGACAGAATTATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172164.1-2357s1c1
Sequence:CCGGCGGAAAGATGATGCAAAGAAACTCGAGTTTCTTTGCATCATCTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_172164.1-302s1c1
Sequence:CCGGGCTAAGAAACTATTGGGTTTACTCGAGTAAACCCAATAGTTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172164.1-2114s1c1
Sequence:CCGGCCCGAAATTAGAGAGAAGATACTCGAGTATCTTCTCTCTAATTTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-232s21c1
Sequence:CCGGCACTGAAGATGGGTTGCATTTCTCGAGAAATGCAACCCATCTTCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172164.1-2755s21c1
Sequence:CCGGTCTGTGTTCCTGATCCTAATTCTCGAGAATTAGGATCAGGAACACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172164.1-1550s1c1
Sequence:CCGGGCTGCTAATGAAGAGACACAACTCGAGTTGTGTCTCTTCATTAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-599s21c1
Sequence:CCGGGAGTTGAGAGAACAGGTTTATCTCGAGATAAACCTGTTCTCTCAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-774s21c1
Sequence:CCGGACTTGACTCTAGATTGGTTAACTCGAGTTAACCAATCTAGAGTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_172164.1-2292s21c1
Sequence:CCGGCAAATTGTGTGACTGATATTTCTCGAGAAATATCAGTCACACAATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_172164.1-2103s21c1
Sequence:CCGGAGGAACTGCTACCCGAAATTACTCGAGTAATTTCGGGTAGCAGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-720s21c1
Sequence:CCGGGAAGAGAAGATATGGATATAACTCGAGTTATATCCATATCTTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172164.1-2992s21c1
Sequence:CCGGGGATGGTTCTTGTCCTATATCCTCGAGGATATAGGACAAGAACCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-1114s21c1
Sequence:CCGGGCCAGAGGAGAAGGTAGTTACCTCGAGGTAACTACCTTCTCCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-1795s21c1
Sequence:CCGGTGCTGCCCAGGCACATCTTAACTCGAGTTAAGATGTGCCTGGGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-1641s21c1
Sequence:CCGGAGACCGAAGAAATGCCAAATGCTCGAGCATTTGGCATTTCTTCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172164
VALIDATED
NASP MISSION shRNA shRNA Plasmid DNA
nuclear autoantigenic sperm protein (histone-binding)
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_172164.1-956s21c1
Sequence:CCGGGAGAAGCAGGGAGAGGTAATTCTCGAGAATTACCTCTCCCTGCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172164.1-3032s1c1
Sequence:CCGGGCTATAATTCTGTCCTGGAAACTCGAGTTTCCAGGACAGAATTATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172164.1-2357s1c1
Sequence:CCGGCGGAAAGATGATGCAAAGAAACTCGAGTTTCTTTGCATCATCTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_172164.1-302s1c1
Sequence:CCGGGCTAAGAAACTATTGGGTTTACTCGAGTAAACCCAATAGTTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172164.1-2114s1c1
Sequence:CCGGCCCGAAATTAGAGAGAAGATACTCGAGTATCTTCTCTCTAATTTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-232s21c1
Sequence:CCGGCACTGAAGATGGGTTGCATTTCTCGAGAAATGCAACCCATCTTCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172164.1-2755s21c1
Sequence:CCGGTCTGTGTTCCTGATCCTAATTCTCGAGAATTAGGATCAGGAACACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172164.1-1550s1c1
Sequence:CCGGGCTGCTAATGAAGAGACACAACTCGAGTTGTGTCTCTTCATTAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-599s21c1
Sequence:CCGGGAGTTGAGAGAACAGGTTTATCTCGAGATAAACCTGTTCTCTCAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-774s21c1
Sequence:CCGGACTTGACTCTAGATTGGTTAACTCGAGTTAACCAATCTAGAGTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_172164.1-2292s21c1
Sequence:CCGGCAAATTGTGTGACTGATATTTCTCGAGAAATATCAGTCACACAATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_172164.1-2103s21c1
Sequence:CCGGAGGAACTGCTACCCGAAATTACTCGAGTAATTTCGGGTAGCAGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-720s21c1
Sequence:CCGGGAAGAGAAGATATGGATATAACTCGAGTTATATCCATATCTTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172164.1-2992s21c1
Sequence:CCGGGGATGGTTCTTGTCCTATATCCTCGAGGATATAGGACAAGAACCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-1114s21c1
Sequence:CCGGGCCAGAGGAGAAGGTAGTTACCTCGAGGTAACTACCTTCTCCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-1795s21c1
Sequence:CCGGTGCTGCCCAGGCACATCTTAACTCGAGTTAAGATGTGCCTGGGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-1641s21c1
Sequence:CCGGAGACCGAAGAAATGCCAAATGCTCGAGCATTTGGCATTTCTTCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172164
VALIDATED
NASP MISSION shRNA Lentiviral Transduction Particles
nuclear autoantigenic sperm protein (histone-binding)
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_172164.1-956s21c1
Sequence:CCGGGAGAAGCAGGGAGAGGTAATTCTCGAGAATTACCTCTCCCTGCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115662    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172164.1-3032s1c1
Sequence:CCGGGCTATAATTCTGTCCTGGAAACTCGAGTTTCCAGGACAGAATTATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172164.1-2357s1c1
Sequence:CCGGCGGAAAGATGATGCAAAGAAACTCGAGTTTCTTTGCATCATCTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A3
TRC Version: 1 Clone ID:NM_172164.1-302s1c1
Sequence:CCGGGCTAAGAAACTATTGGGTTTACTCGAGTAAACCCAATAGTTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172164.1-2114s1c1
Sequence:CCGGCCCGAAATTAGAGAGAAGATACTCGAGTATCTTCTCTCTAATTTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-232s21c1
Sequence:CCGGCACTGAAGATGGGTTGCATTTCTCGAGAAATGCAACCCATCTTCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358644    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172164.1-2755s21c1
Sequence:CCGGTCTGTGTTCCTGATCCTAATTCTCGAGAATTAGGATCAGGAACACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172164.1-1550s1c1
Sequence:CCGGGCTGCTAATGAAGAGACACAACTCGAGTTGTGTCTCTTCATTAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-599s21c1
Sequence:CCGGGAGTTGAGAGAACAGGTTTATCTCGAGATAAACCTGTTCTCTCAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-774s21c1
Sequence:CCGGACTTGACTCTAGATTGGTTAACTCGAGTTAACCAATCTAGAGTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_172164.1-2292s21c1
Sequence:CCGGCAAATTGTGTGACTGATATTTCTCGAGAAATATCAGTCACACAATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_172164.1-2103s21c1
Sequence:CCGGAGGAACTGCTACCCGAAATTACTCGAGTAATTTCGGGTAGCAGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-720s21c1
Sequence:CCGGGAAGAGAAGATATGGATATAACTCGAGTTATATCCATATCTTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232453    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172164.1-2992s21c1
Sequence:CCGGGGATGGTTCTTGTCCTATATCCTCGAGGATATAGGACAAGAACCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-1114s21c1
Sequence:CCGGGCCAGAGGAGAAGGTAGTTACCTCGAGGTAACTACCTTCTCCTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-1795s21c1
Sequence:CCGGTGCTGCCCAGGCACATCTTAACTCGAGTTAAGATGTGCCTGGGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172164.1-1641s21c1
Sequence:CCGGAGACCGAAGAAATGCCAAATGCTCGAGCATTTGGCATTTCTTCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016777
VALIDATED
NASP MISSION shRNA Bacterial Glycerol Stock
nuclear autoantigenic sperm protein (histone-binding)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-1984s1c1
Sequence:CCGGGCTACCTGAAATTCGAGAGAACTCGAGTTCTCTCGAATTTCAGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-206s1c1
Sequence:CCGGGTGGATAGTGAAGCTAAGAAACTCGAGTTTCTTAGCTTCACTATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-1799s1c1
Sequence:CCGGGCAGAGACTCACTACCAATTACTCGAGTAATTGGTAGTGAGTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-218s1c1
Sequence:CCGGGCTAAGAAACTACTGGGATTACTCGAGTAATCCCAGTAGTTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-1612s1c1
Sequence:CCGGGCTGGATTTAGCCAAGATCATCTCGAGATGATCTTGGCTAAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-2387s21c1
Sequence:CCGGGGAGTCTGCAGCTACAATTAACTCGAGTTAATTGTAGCTGCAGACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-1809s21c1
Sequence:CCGGGCAGAGACTCACTACCAATTACTCGAGTAATTGGTAGTGAGTCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-228s21c1
Sequence:CCGGGCTAAGAAACTACTGGGATTACTCGAGTAATCCCAGTAGTTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-216s21c1
Sequence:CCGGGTGGATAGTGAAGCTAAGAAACTCGAGTTTCTTAGCTTCACTATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016777.3-643s21c1
Sequence:CCGGGAAGAGAAGACATGGATATAACTCGAGTTATATCCATGTCTTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016777
VALIDATED
NASP MISSION shRNA shRNA Plasmid DNA
nuclear autoantigenic sperm protein (histone-binding)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-1984s1c1
Sequence:CCGGGCTACCTGAAATTCGAGAGAACTCGAGTTCTCTCGAATTTCAGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-206s1c1
Sequence:CCGGGTGGATAGTGAAGCTAAGAAACTCGAGTTTCTTAGCTTCACTATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-1799s1c1
Sequence:CCGGGCAGAGACTCACTACCAATTACTCGAGTAATTGGTAGTGAGTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-218s1c1
Sequence:CCGGGCTAAGAAACTACTGGGATTACTCGAGTAATCCCAGTAGTTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-1612s1c1
Sequence:CCGGGCTGGATTTAGCCAAGATCATCTCGAGATGATCTTGGCTAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-2387s21c1
Sequence:CCGGGGAGTCTGCAGCTACAATTAACTCGAGTTAATTGTAGCTGCAGACTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-1809s21c1
Sequence:CCGGGCAGAGACTCACTACCAATTACTCGAGTAATTGGTAGTGAGTCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-228s21c1
Sequence:CCGGGCTAAGAAACTACTGGGATTACTCGAGTAATCCCAGTAGTTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-216s21c1
Sequence:CCGGGTGGATAGTGAAGCTAAGAAACTCGAGTTTCTTAGCTTCACTATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016777.3-643s21c1
Sequence:CCGGGAAGAGAAGACATGGATATAACTCGAGTTATATCCATGTCTTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016777
VALIDATED
NASP MISSION shRNA Lentiviral Transduction Particles
nuclear autoantigenic sperm protein (histone-binding)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-1984s1c1
Sequence:CCGGGCTACCTGAAATTCGAGAGAACTCGAGTTCTCTCGAATTTCAGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-206s1c1
Sequence:CCGGGTGGATAGTGAAGCTAAGAAACTCGAGTTTCTTAGCTTCACTATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-1799s1c1
Sequence:CCGGGCAGAGACTCACTACCAATTACTCGAGTAATTGGTAGTGAGTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-218s1c1
Sequence:CCGGGCTAAGAAACTACTGGGATTACTCGAGTAATCCCAGTAGTTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016777.2-1612s1c1
Sequence:CCGGGCTGGATTTAGCCAAGATCATCTCGAGATGATCTTGGCTAAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-2387s21c1
Sequence:CCGGGGAGTCTGCAGCTACAATTAACTCGAGTTAATTGTAGCTGCAGACTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-1809s21c1
Sequence:CCGGGCAGAGACTCACTACCAATTACTCGAGTAATTGGTAGTGAGTCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-228s21c1
Sequence:CCGGGCTAAGAAACTACTGGGATTACTCGAGTAATCCCAGTAGTTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016777.3-216s21c1
Sequence:CCGGGTGGATAGTGAAGCTAAGAAACTCGAGTTTCTTAGCTTCACTATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016777.3-643s21c1
Sequence:CCGGGAAGAGAAGACATGGATATAACTCGAGTTATATCCATGTCTTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)